ID: 1148476291

View in Genome Browser
Species Human (GRCh38)
Location 17:47930900-47930922
Sequence ATTCCATGCCTGGAAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148476283_1148476291 29 Left 1148476283 17:47930848-47930870 CCTCTCTGTCCAGCTGACACTTG No data
Right 1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG No data
1148476285_1148476291 20 Left 1148476285 17:47930857-47930879 CCAGCTGACACTTGGCATTGTGC No data
Right 1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG No data
1148476287_1148476291 -10 Left 1148476287 17:47930887-47930909 CCCACAGCCTAGGATTCCATGCC No data
Right 1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148476291 Original CRISPR ATTCCATGCCTGGAAGAAAG AGG Intergenic
No off target data available for this crispr