ID: 1148479217

View in Genome Browser
Species Human (GRCh38)
Location 17:47949289-47949311
Sequence CAATAAAGTGCACGGCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148479217_1148479231 26 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479231 17:47949338-47949360 AACCCCCAAGGAGGGGACTTGGG No data
1148479217_1148479230 25 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479230 17:47949337-47949359 CAACCCCCAAGGAGGGGACTTGG No data
1148479217_1148479225 17 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479225 17:47949329-47949351 GTCTCCCTCAACCCCCAAGGAGG No data
1148479217_1148479220 -5 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479220 17:47949307-47949329 TATTGATGTTCAACCCGGCCTGG No data
1148479217_1148479226 18 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479226 17:47949330-47949352 TCTCCCTCAACCCCCAAGGAGGG No data
1148479217_1148479219 -10 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479219 17:47949302-47949324 CACTTTATTGATGTTCAACCCGG No data
1148479217_1148479227 19 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG No data
1148479217_1148479224 14 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479224 17:47949326-47949348 CTGGTCTCCCTCAACCCCCAAGG No data
1148479217_1148479232 27 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479232 17:47949339-47949361 ACCCCCAAGGAGGGGACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148479217 Original CRISPR CAATAAAGTGCACGGCTGAT AGG (reversed) Intergenic
No off target data available for this crispr