ID: 1148479227

View in Genome Browser
Species Human (GRCh38)
Location 17:47949331-47949353
Sequence CTCCCTCAACCCCCAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148479217_1148479227 19 Left 1148479217 17:47949289-47949311 CCTATCAGCCGTGCACTTTATTG No data
Right 1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG No data
1148479218_1148479227 11 Left 1148479218 17:47949297-47949319 CCGTGCACTTTATTGATGTTCAA No data
Right 1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148479227 Original CRISPR CTCCCTCAACCCCCAAGGAG GGG Intergenic
No off target data available for this crispr