ID: 1148484147

View in Genome Browser
Species Human (GRCh38)
Location 17:47979819-47979841
Sequence GAGGCTCCTCCCAGCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148484138_1148484147 21 Left 1148484138 17:47979775-47979797 CCTGAAAGTTCTGTCCTCACCCA 0: 1
1: 0
2: 2
3: 17
4: 190
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264
1148484140_1148484147 2 Left 1148484140 17:47979794-47979816 CCCAGTTCTCTCCTCTTTCTGCC 0: 1
1: 0
2: 9
3: 90
4: 683
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264
1148484139_1148484147 7 Left 1148484139 17:47979789-47979811 CCTCACCCAGTTCTCTCCTCTTT 0: 1
1: 0
2: 9
3: 91
4: 744
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264
1148484143_1148484147 -9 Left 1148484143 17:47979805-47979827 CCTCTTTCTGCCCAGAGGCTCCT 0: 1
1: 0
2: 2
3: 49
4: 387
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264
1148484141_1148484147 1 Left 1148484141 17:47979795-47979817 CCAGTTCTCTCCTCTTTCTGCCC 0: 1
1: 0
2: 8
3: 124
4: 928
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264
1148484137_1148484147 24 Left 1148484137 17:47979772-47979794 CCTCCTGAAAGTTCTGTCCTCAC 0: 1
1: 0
2: 1
3: 17
4: 209
Right 1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148484147 Original CRISPR GAGGCTCCTCCCAGCCTCAA GGG Intronic
900176550 1:1293785-1293807 GAGGCCCCGCCCAGCCCCGAGGG + Intronic
900335565 1:2161332-2161354 GGGGCTCTTCCCAGCATCAGGGG + Intronic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
901024200 1:6270451-6270473 CAGGCTCCTCCGAGCCTCTGGGG + Intronic
901451626 1:9339678-9339700 GAGGCCCCTCCCCTCCTCACAGG - Intronic
902835903 1:19046693-19046715 AAAGCTCCACCCAGGCTCAAGGG + Intergenic
902889225 1:19429743-19429765 GAGACTCCTGGCAGCCTGAATGG - Intronic
903354254 1:22736628-22736650 GAGGCTGCCCCCACCCTCAAAGG - Intronic
903603232 1:24556813-24556835 GAATCTTCTCCCAGACTCAAGGG - Intronic
904605990 1:31697978-31698000 CAGCCTCCTCCCAGCCTCTGGGG - Exonic
905342998 1:37292100-37292122 GGGGCTAGTCCCAGCCTCTAAGG - Intergenic
907237753 1:53063166-53063188 GAGGCTCCTGGCAGCCTCGGGGG + Intronic
908401475 1:63775475-63775497 AAGGCTCCTCACCCCCTCAAGGG - Intronic
908758832 1:67493394-67493416 GAGACCCATCCCAGCCTCAAAGG + Intergenic
910436430 1:87210531-87210553 CAGGCCTCTCCCAGCCTCAGGGG + Intergenic
911747280 1:101453735-101453757 GACACTCCTCCCAGCCTCTTGGG + Intergenic
915302057 1:154957329-154957351 TGCTCTCCTCCCAGCCTCAAAGG + Exonic
919810143 1:201404159-201404181 GAGGCTCCTCAGAACCTCGAGGG - Intronic
920435278 1:205943207-205943229 GAGGCTGCTCTCAGACTCCAGGG + Intronic
921050679 1:211509102-211509124 TAGGCTCTGCCCAGCCTCACTGG + Intergenic
922243937 1:223776678-223776700 GAGGCCCCTCCCATCCGCAGAGG + Intergenic
922800037 1:228360973-228360995 GAGGCTCCTGCCAGGCTGACAGG - Intronic
922967208 1:229700479-229700501 TAGGCTCAGCCCAGACTCAAGGG + Intergenic
923770118 1:236930938-236930960 GATGTTCCTCCCATCCTCATAGG - Intergenic
1063486948 10:6429106-6429128 CAGGCCCCTCCCACCCTCCAAGG + Intronic
1066153807 10:32653243-32653265 GAGACTCACCCCAGCCCCAAGGG - Intronic
1066661126 10:37738969-37738991 GAGGCCTCTCCCAGCCTGATGGG + Intergenic
1068438336 10:57019256-57019278 CAGGCTCCTTCCTGCTTCAAAGG + Intergenic
1069039555 10:63681068-63681090 GCAGCTCCTCCCAGCATCAGTGG - Intergenic
1069741684 10:70689017-70689039 TGGGCCCCTGCCAGCCTCAAGGG - Intronic
1069841556 10:71342681-71342703 CAGTGTCCTCCCAGCCTCAGAGG + Intronic
1071044826 10:81361170-81361192 CAGGCTCCTCCCCACCGCAAAGG - Intergenic
1071728382 10:88222382-88222404 GAGCCTCCTCCCAGACTCCAAGG - Intergenic
1073546442 10:104353583-104353605 GGGACTCCTCCCAGCCTCTCAGG + Intergenic
1074107295 10:110398174-110398196 GAGGCACATCCCAGCCTTCAAGG - Intergenic
1075155716 10:119974479-119974501 GAGGCTTCTCCCAGCCTCCCAGG - Intergenic
1075469911 10:122680251-122680273 GATGCTCCTTCCAGCTTCAAGGG - Intergenic
1075560771 10:123466972-123466994 GGGTCTCATCCCAGCCTCACTGG + Intergenic
1076465420 10:130677945-130677967 GAGACTCCTTCCATCCTAAATGG - Intergenic
1076613060 10:131738227-131738249 GACCCTCCTCCCAGCCTTGAAGG - Intergenic
1076747664 10:132522560-132522582 GAGGCTCCTTCCAGCCAACAGGG - Intergenic
1076846160 10:133070488-133070510 CCAGCTCCTCCGAGCCTCAAAGG - Intergenic
1077183077 11:1225001-1225023 CTGCCTCCTCCCAGCCTCCATGG + Intronic
1077317179 11:1924821-1924843 GAGGCCCCTCCCACCCTCCTGGG - Intronic
1077540427 11:3144066-3144088 ATGGCTCCTCCCATCCTCAGGGG + Intronic
1079989720 11:27233870-27233892 GAGGCTCTTACCACCCTGAAAGG + Intergenic
1080762972 11:35270286-35270308 GAGGCTAATCCCAACCTCACAGG + Intronic
1080816062 11:35758578-35758600 CAGTTTCTTCCCAGCCTCAATGG + Intronic
1081603309 11:44510633-44510655 GTGGCTCCACCCAGCCACAAGGG + Intergenic
1083699146 11:64463271-64463293 AAGCCTCCTCCTAGGCTCAAGGG + Intergenic
1084147960 11:67275069-67275091 GCGGCCCCTCCCAGCCTCTGAGG + Intronic
1084618041 11:70249593-70249615 CAGGCTTCTCCCAGCTTCTAGGG + Intergenic
1084652977 11:70499882-70499904 TAGGCTCCTCCCAACTCCAAGGG + Intronic
1084672341 11:70614783-70614805 GAGGCTCACCCCAGGCTCAGAGG - Intronic
1084925507 11:72508214-72508236 CAGGCTCCTCCCTGCTGCAAAGG + Intergenic
1085342610 11:75743240-75743262 GAGGCACCTCACAGCCTGGAGGG - Intergenic
1085545886 11:77317975-77317997 GAGCCTCCTTCCAGGCTCACTGG - Intergenic
1086403661 11:86481819-86481841 AAGGCTCCTCACAGCTCCAAAGG + Intronic
1087051038 11:93886782-93886804 GAGACTCCAGCCAGCCTTAATGG + Intergenic
1087082686 11:94187071-94187093 AAGGCACCATCCAGCCTCAAGGG - Intergenic
1087789397 11:102391153-102391175 GAGGCACCTCCCGGCCTCTCTGG - Intergenic
1088337965 11:108729468-108729490 GAGGCTGCTCCCTGCATCAAAGG - Intronic
1089329356 11:117679020-117679042 GGGGCTCCTCCCAGGCTCAGCGG + Intronic
1089679371 11:120110805-120110827 GACCCTCCTGCCAGCCTCAAAGG + Intergenic
1090265084 11:125348570-125348592 CAGTCTCCTCTCAGCCTCATGGG + Intronic
1091763542 12:3103676-3103698 GAGGCAGCCACCAGCCTCAAAGG + Intronic
1093415140 12:18911273-18911295 GTGGCTCCACTCAGCCTAAAAGG - Intergenic
1094792684 12:33932482-33932504 CAGTTTCCTCCTAGCCTCAATGG - Intergenic
1096024652 12:48350680-48350702 GATCCTCCTCCCAGCCCCTATGG + Exonic
1098435894 12:70468043-70468065 CAGGCTCCTCCCTGCTGCAAAGG - Intergenic
1099439822 12:82686774-82686796 GAGGCTCCTCCCACCCTCCCCGG - Intergenic
1102215957 12:111161370-111161392 GAAGCTGGTCCCAGCCTCCAGGG - Intronic
1103701865 12:122852282-122852304 CAGGCTCTTCCCAGGCACAAGGG - Intronic
1103901936 12:124307873-124307895 GAGGCTCCTTCCTGCCTCTCTGG + Intronic
1103904703 12:124321389-124321411 GGGGCTCTGCCCAGCCTCACTGG - Intergenic
1106081059 13:26500711-26500733 GGGGCTCAGCCCAGCCTCACGGG + Intergenic
1106642691 13:31601011-31601033 AAGGCTGCTCTCAGCCTCAACGG - Intergenic
1107937256 13:45355526-45355548 GAGGCTCATTCCTGCCTTAATGG + Intergenic
1108131301 13:47303600-47303622 CAGGCTCCTCCCAGGCTTCATGG - Intergenic
1108635894 13:52334043-52334065 GAGGCTCCTCCAGGCCTCGTGGG + Intergenic
1108651916 13:52489205-52489227 GAGGCTCCTCCAGGCCTCGTGGG - Intergenic
1110413306 13:75226364-75226386 GAGGCTCCTCCAGGCTGCAAAGG - Intergenic
1111262686 13:85762253-85762275 CAAGCTCCTTCCAGCCTCAAAGG + Intergenic
1115152588 14:30302656-30302678 GAGGGTTCTGCCAGCCTCCAGGG + Intergenic
1119085745 14:71737334-71737356 GAGCCTCTTCCCAGCGCCAATGG - Intronic
1120540881 14:85748928-85748950 CAGGTTCCTCCTATCCTCAAGGG - Intergenic
1120598551 14:86472043-86472065 CAGTTTCTTCCCAGCCTCAATGG + Intergenic
1122079061 14:99254387-99254409 GGGGTTCCTCCCACCCTTAAGGG - Intronic
1122276706 14:100594451-100594473 GTGGCTGCGGCCAGCCTCAAAGG + Intergenic
1122862003 14:104586919-104586941 GAGGCTCCATCCAGCCTCTGAGG + Intronic
1124214720 15:27796952-27796974 GAGGATTCTCCCAACCTCACAGG + Intronic
1124888115 15:33706064-33706086 GAGGCTCTTTCTAGCCTCCAGGG + Intronic
1126292710 15:47099865-47099887 GAGGCACCTCCAAGCCTGCAAGG + Intergenic
1127453133 15:59135743-59135765 GAGGATCCTGAAAGCCTCAAAGG + Exonic
1128570438 15:68729719-68729741 AAAGCTCATCCCAGCCTCCAAGG - Intergenic
1130760361 15:86813192-86813214 GAGGCCCCCCCAACCCTCAAAGG - Intronic
1132682877 16:1150819-1150841 GAGGCTCTTTCCAGCAGCAACGG - Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1134100940 16:11450896-11450918 GAGTCTCATCACAGCCGCAATGG + Intronic
1137009782 16:35310998-35311020 AAGGCTCCTGCCAGCCTGATTGG - Intergenic
1137743635 16:50804654-50804676 GAGGCCCATCCCACCCCCAATGG - Intergenic
1137887271 16:52118775-52118797 GAGGCTGCTCCCAGGATAAATGG + Intergenic
1138257572 16:55580079-55580101 GAGTCTCCATCCAGCCTCAGGGG - Intronic
1141994729 16:87629035-87629057 AAGGCTCCTTCCAGGCTCCAGGG + Intronic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1142693557 17:1621219-1621241 GAGGCTCCTCTTTGCCTCAGGGG - Intronic
1143345410 17:6245399-6245421 GAGGCTCCTGCCAGCTTGACTGG - Intergenic
1144752384 17:17658102-17658124 GAAGCTCCTCCCTGCTGCAAAGG + Intergenic
1144807625 17:17978229-17978251 GATGTGCCTCCCTGCCTCAAGGG - Intronic
1145123506 17:20281524-20281546 GACTCTACTCCCAGCCTCGAGGG + Intronic
1145788782 17:27611319-27611341 GAGGCTCCTCCCAGCCCTAGAGG - Intronic
1146658641 17:34650052-34650074 GAGCTGCCTCCCAGCCTCCATGG - Intergenic
1147627279 17:41908284-41908306 CAAGCTCTTCCCAGCATCAAGGG + Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1148536149 17:48440683-48440705 GAGGATCCTCCCACCCTCAGTGG + Intergenic
1148578837 17:48729269-48729291 GAGGCCGCTCCCGGCCTCAGAGG + Intergenic
1148865667 17:50626861-50626883 GGCGCTCCTCCCTGCCTCAGTGG + Exonic
1148942305 17:51225639-51225661 GAGCCACCTCCCTGCCTCAAGGG + Intronic
1151775406 17:76197954-76197976 CAGGTTCCTCCCATCTTCAAGGG - Intronic
1152019745 17:77774440-77774462 CAGCCTCCTCCCAGCCTCCTGGG - Intergenic
1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG + Intronic
1152515561 17:80821779-80821801 GAGACTCCTCCCAGCATGGACGG + Intronic
1152658336 17:81530308-81530330 GAGGCACCTCCCTGCCCCAGTGG + Intronic
1152891337 17:82883299-82883321 GCGCCTCCTACCAGCCTAAAGGG - Intronic
1154189218 18:12214845-12214867 GAGACTCCTCCATGCCTCATAGG - Intergenic
1154343574 18:13524131-13524153 GAGGCTCCTCTCAGTTACAAGGG - Intronic
1155797635 18:30059970-30059992 CAGGCTCCTCCCCGCTGCAAAGG + Intergenic
1156367250 18:36440513-36440535 GGGGCTCCTCCGGGCCTCCACGG + Intronic
1156475359 18:37402460-37402482 GGGGGTCCACCCAGGCTCAAAGG - Intronic
1157631881 18:49106484-49106506 CAGTTTCTTCCCAGCCTCAATGG + Intronic
1157641379 18:49217817-49217839 CAGGTTCTTCCCAGCCTCGACGG - Intronic
1158738167 18:60107642-60107664 GTGGCTCCTCCCAGACTCCATGG + Intergenic
1160528099 18:79548914-79548936 GCGGCTCCTTCCAGCGTCACAGG + Intergenic
1161104805 19:2438021-2438043 GAGGCTCCTTCCTGCCTCTTAGG - Intronic
1161752386 19:6107531-6107553 CATGCACCTCCCAGGCTCAAGGG - Intronic
1161975896 19:7607648-7607670 CCAGCTCCTCCCAGCCCCAAGGG - Intronic
1163234540 19:16022987-16023009 GGGGCTCAGCCCAGCCTCATGGG + Intergenic
1163350368 19:16773114-16773136 GAGGCTCCTCTCTGCAACAAAGG - Exonic
1163491782 19:17620946-17620968 GAGGCTGCTTCCAGCCTCCTGGG - Intronic
1163509748 19:17727519-17727541 GAGGCTCAGCCCAGCCTCACTGG - Exonic
1163629833 19:18412660-18412682 GAGGCTCATCACGGCATCAAGGG - Intergenic
1163843124 19:19623745-19623767 GTGGCTCCTTGCAGCCTCCAGGG - Exonic
1163915289 19:20235924-20235946 GACACTGCACCCAGCCTCAAGGG + Intergenic
1164246701 19:23436274-23436296 TTGGCTCCTCCCACCCTAAAAGG + Intergenic
1164673837 19:30088951-30088973 GAGGTGCCCCCCAGCCTCGAGGG - Intergenic
1165600528 19:37052440-37052462 CAGTCTCTTCCTAGCCTCAATGG + Intronic
1166979035 19:46621911-46621933 GAGGGTCCTCCCAGCTTCCAAGG - Intronic
1167270589 19:48503566-48503588 CAGCCTCCTCCCAGCCTCCCTGG + Intronic
1167645249 19:50702306-50702328 TATGGTCCTCCAAGCCTCAAGGG + Intronic
1167998515 19:53426113-53426135 GGGGCTTCTCCCAGCCCCACTGG - Intronic
1168643106 19:58042861-58042883 GAGGATCCTCTCAGCCACAGCGG - Intronic
926337152 2:11872390-11872412 AAGGCTCCTTTCAGCCTCAGCGG - Intergenic
927172706 2:20383638-20383660 GAGGCTGCTTCCAGTCTCCAAGG - Intergenic
929091202 2:38218774-38218796 GAGGTTCCTCCAAGCCCCAGGGG - Intergenic
931452605 2:62380859-62380881 GAGGCTCCTCTCAGCCCCTCTGG - Intergenic
932159110 2:69444691-69444713 GGGTCTCCTTCCAGCCTCACAGG - Intergenic
932197384 2:69796344-69796366 GGGGCTCCTCCCAGTCCCTATGG + Intronic
932288703 2:70557160-70557182 GAGTCTCCACACAGCTTCAAGGG - Intergenic
932449677 2:71801667-71801689 GAGGCTCCTCACAGCATGGAAGG + Intergenic
932770559 2:74498622-74498644 GAGGCTCCTAAAAGCCTCAAAGG - Intronic
932977093 2:76615973-76615995 GCCACTGCTCCCAGCCTCAAGGG - Intergenic
934660151 2:96138846-96138868 GAGGTTCCTTCCTGCCTCCAGGG + Intergenic
935251252 2:101263470-101263492 GAGGATCCCCTGAGCCTCAAGGG - Intronic
935574831 2:104698411-104698433 GATACTCCTCTCAGCCTCATTGG - Intergenic
937911889 2:127079856-127079878 CAGGCTCCTCCCAGACAAAATGG + Intronic
942178443 2:173356323-173356345 GAGGCCCCAGACAGCCTCAAAGG - Intronic
944858418 2:203790588-203790610 CAGGTTCCTCACAGCCTTAAAGG - Intergenic
946389170 2:219405183-219405205 GTGGCCCCTCCCAGCCCCAAGGG + Intergenic
948596669 2:239083804-239083826 GAGGGTCCTCCCAGGCTCCCAGG + Intronic
948615261 2:239194460-239194482 GACGCTCCTGCCCGCCTCACAGG + Intronic
948864311 2:240767679-240767701 GGGGCTCACCCCAGCCTCAGAGG - Intronic
1169191569 20:3661612-3661634 GGGGCTCCTCCTACACTCAATGG + Intronic
1169481555 20:5986907-5986929 GCCTCTCCTCCCAGGCTCAAGGG + Intronic
1170568110 20:17617935-17617957 CAGGCTCCACCCAGCCTCACCGG - Intronic
1170880042 20:20289033-20289055 AAGGCTCCTCCGTACCTCAATGG + Intronic
1171400095 20:24867554-24867576 GAGGGTCCTCTGACCCTCAAGGG + Intergenic
1171481916 20:25460787-25460809 GAGGCTCAGCCGAGCCTCACAGG + Intronic
1173554293 20:43954582-43954604 GAGCCTCCAGCCACCCTCAAAGG - Intronic
1175031570 20:55960059-55960081 GGGGCTCTTCCCAGGCTCTAAGG + Intergenic
1175368704 20:58472149-58472171 GAGGCAACCCCCAACCTCAAGGG - Intronic
1175815507 20:61881303-61881325 GAGCCTCCTCTCAGACTCCATGG - Intronic
1175916061 20:62426574-62426596 GAGTCTCCTCCCACCCTCTGTGG + Intronic
1176187706 20:63790257-63790279 GATGCTCCTCCCAGCCATCACGG + Exonic
1176425849 21:6547763-6547785 GAGGTTCCGCCCTGCCTCGAGGG - Intergenic
1179701340 21:43156080-43156102 GAGGTTCCGCCCTGCCTCGAGGG - Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1181275767 22:21686715-21686737 CAGGCTCACCCCAGCCTCATGGG - Intronic
1181277679 22:21696826-21696848 GAGGCGCCACCCAGCATCCAGGG - Exonic
1183512451 22:38244041-38244063 CAGGTGCTTCCCAGCCTCAAGGG - Intronic
1183628402 22:39018573-39018595 GAGGCTCCTTTCTGCCTCCATGG + Exonic
1183673939 22:39289554-39289576 AGGGCTCCTCCCAGCCCCAGTGG - Intergenic
1183881724 22:40837732-40837754 AAGGATCCTCCCAGCCTCAAGGG + Intronic
1185058881 22:48595226-48595248 GTGCCTCCTCCCAGGCTCCATGG - Intronic
1185247536 22:49781128-49781150 CAGGGTCCACCCACCCTCAAGGG + Intronic
1185315283 22:50176401-50176423 GAGGCGCCCCTCACCCTCAAGGG + Intronic
949421954 3:3875342-3875364 GAGGACCCTCCCAGCCTCCAGGG - Intronic
954081999 3:48217913-48217935 GAGGCTCTGCCCAGCCATAAAGG - Intergenic
955806905 3:62746155-62746177 TAGGTTCCTCCCACACTCAAGGG - Intronic
957780615 3:84813850-84813872 CAGTCTCTTCCTAGCCTCAATGG + Intergenic
960596879 3:119414978-119415000 GAGGCTCCTCCCAACCAGAAGGG + Exonic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
966854143 3:184182708-184182730 GAAACTCCTCCAAGCCCCAATGG + Intronic
968412887 4:404542-404564 ATGTCTCCTTCCAGCCTCAAAGG - Intergenic
968425350 4:519584-519606 GATGCTCATCCCTGCCTCATAGG + Intronic
968901622 4:3434892-3434914 GTGGCTCCTCCCAGCCCCTTTGG + Intronic
969075550 4:4575253-4575275 AAGGCGCCTCCCATCCCCAAAGG + Intergenic
969590645 4:8120098-8120120 GAGGCTCCTCTCAGGCTCTGGGG - Intronic
970721315 4:18992595-18992617 CAGGCTCCTCCCCGCTGCAAAGG - Intergenic
975986063 4:80202476-80202498 GCGGCCCCTCCCGGCCTCCAAGG + Exonic
976609520 4:87015634-87015656 GAGGCCCCTCCCTGCCCTAAGGG - Intronic
980571659 4:134627585-134627607 CAGGCTCCTCCCTGCTTCAAAGG - Intergenic
980722408 4:136716169-136716191 CAGGCTCCTCCCAGCTGCAGAGG - Intergenic
981491126 4:145340518-145340540 CAGGCTCCTCCCCGCTGCAATGG - Intergenic
982624329 4:157746783-157746805 CAGGCTACTACCAGACTCAAAGG - Intergenic
985385934 4:189448269-189448291 CAGGCTCCTCCCTGCTGCAAAGG - Intergenic
985445296 4:190018331-190018353 GAGCCTCCTCCAAGGCTCTATGG + Intergenic
986056874 5:4146803-4146825 GTGGCTTCTCCCAGCTTCACAGG - Intergenic
988516848 5:31912394-31912416 GAGGCCCATCTCAGCCTCCAAGG - Intronic
988659249 5:33246630-33246652 CAGGCTCCTCCCAGATGCAAAGG - Intergenic
991014452 5:61915977-61915999 GAGGCTCCTCCCCACTGCAAAGG - Intergenic
995553233 5:113300801-113300823 GAGCCTCTCACCAGCCTCAATGG + Intronic
997861482 5:137421876-137421898 CAGTTTCTTCCCAGCCTCAATGG + Intronic
998232246 5:140368082-140368104 GAGGCCCCTCCCAGTCCCCATGG - Intronic
999760042 5:154692725-154692747 GTGCCTCCTGCCAACCTCAAAGG + Intergenic
1001241999 5:170078195-170078217 GAAGCTCCTCCCAACCACGATGG + Intronic
1001638314 5:173228353-173228375 GAGATTCCTCTCAGACTCAAAGG + Intergenic
1002082977 5:176748467-176748489 GAGGCTACACCCAGCCCCAGAGG + Intergenic
1002466384 5:179410887-179410909 GAGGCTGGCCCCAGCCCCAAAGG + Intergenic
1002474487 5:179456264-179456286 GAGGCTCCTCCCTGCTGCAAAGG + Intergenic
1005487504 6:26314826-26314848 GAGGATCCTCCTGGCCTCAAGGG - Intergenic
1005836083 6:29710641-29710663 GAGCCTCCACCCACCCTCACAGG + Intergenic
1007290785 6:40784868-40784890 GATGCTTTTCCCAACCTCAAGGG + Intergenic
1008765166 6:54903967-54903989 GAGGTTTCTCCCAGCCATAATGG - Intronic
1010594235 6:77745032-77745054 CAGTTTCCTCCTAGCCTCAATGG - Intronic
1015266320 6:131295256-131295278 CAGGCTCCTCCCCGCTGCAAAGG - Intergenic
1015928590 6:138334625-138334647 GAGGAGCCTCCCATCTTCAAGGG + Exonic
1016971931 6:149772082-149772104 GAGGCACTTCTAAGCCTCAAAGG - Intronic
1017038506 6:150288602-150288624 GAGGCTGCTCCCTCCCTCAAAGG - Intergenic
1018800595 6:167219259-167219281 GTGAATCCTCCCAGCCTCCATGG + Intergenic
1019708753 7:2508843-2508865 GAGACTCCTCTCAGCCTCCCTGG - Intergenic
1021687284 7:23199260-23199282 GAGGCTGGTCCCAGACTCATAGG + Intronic
1021960607 7:25869191-25869213 GAGGCTCATCCCTGGCACAAAGG - Intergenic
1023278043 7:38541601-38541623 AAGGCTCATGCCAGCCTCAGAGG - Intronic
1026523290 7:71134074-71134096 GAGGCTCCACCCATCCACAGAGG + Intronic
1027131939 7:75597432-75597454 GAGGCCGCACCCAGCCTCAGAGG - Intronic
1027133992 7:75611616-75611638 GGGGCCCCTCCCAGCACCAAGGG + Intronic
1030245930 7:107384401-107384423 CAGGCTCCTCCCTGCTGCAAAGG - Intronic
1031056501 7:116998084-116998106 GAGCCTCCCCCCTGCCTCCATGG - Intronic
1033035614 7:137873473-137873495 GAGGCTGATCCCAGACTCATGGG - Intergenic
1034901874 7:154912972-154912994 GAGGCCTTTCCAAGCCTCAAGGG + Intergenic
1035689057 8:1547838-1547860 AAAGCTCCTCCCATCCTCACTGG + Intronic
1036055800 8:5252360-5252382 GAGGCTCTGCCCACACTCAAGGG + Intergenic
1036591373 8:10172067-10172089 GAGGCTCCTCCTAGTCCCCATGG - Intronic
1037194936 8:16177409-16177431 GTGCCTCCTCCCAGCTTCTACGG - Intronic
1037259835 8:16996061-16996083 CAGGCTCCTCCCCGCTGCAAAGG - Intronic
1037807737 8:22067716-22067738 GAGGCCCCCCCCAGCCACACTGG + Intronic
1038433033 8:27515075-27515097 CAGGCTCCTCCCTGCTGCAAAGG - Intronic
1039352573 8:36779240-36779262 CAGGCTCCTCCCTGCTCCAAAGG - Intergenic
1039858757 8:41438476-41438498 GCTGCTCCTCCCAGCCCCGATGG + Intergenic
1043428525 8:80171781-80171803 CAGGCTCCACGCAGCCTCCATGG - Intronic
1044517296 8:93154491-93154513 GTAGATCCTCCCAGTCTCAAGGG - Intronic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1049347051 8:142144731-142144753 CAGGGTCCCCCCAGCCTCAGTGG + Intergenic
1049595260 8:143480451-143480473 GAGGCCCCTCTCAGCCTGCACGG - Intronic
1052693567 9:31848631-31848653 CAGGCTCCTCCCCGCTGCAAAGG - Intergenic
1053005683 9:34602775-34602797 GAAGCTCCTCCCAGCCCACAAGG - Intergenic
1055945232 9:81687637-81687659 GAAGCTCTTCCCAGTCTCCAGGG + Intronic
1056914449 9:90733381-90733403 CAAGCTCCTCCCAGCTGCAAAGG + Intergenic
1058643799 9:107111893-107111915 GAGCCTCCTCCCTGCCTAAATGG + Intergenic
1058848277 9:108984346-108984368 GATGCTTCTCACAGCTTCAAAGG - Exonic
1058956546 9:109954003-109954025 GAGATGCCTCCCAGCCTCCAGGG - Intronic
1059608900 9:115870094-115870116 GAGTCTCCTGCCAGCCTGCAGGG + Intergenic
1060784750 9:126442258-126442280 GAGGCTCCTCCCATCAGAAATGG + Intronic
1061080152 9:128365117-128365139 GAGGCGCCTCCCAGCCTCCCGGG + Intergenic
1061848274 9:133400320-133400342 CAGGCTCCTACCAGCCTCTGGGG + Intronic
1061985705 9:134129154-134129176 GTGGCTGCTCCCTGCCTCCAAGG + Intergenic
1062086280 9:134650621-134650643 GAGGCACCTGCCAGCCCCATGGG + Intronic
1062444545 9:136588128-136588150 GTGGCTCCTCCCAGCTGCAGGGG + Intergenic
1062570106 9:137181044-137181066 AGGGCTGCTCCCAGCCTCGAGGG - Intronic
1062653757 9:137591274-137591296 GAGGCCTCACCCTGCCTCAAGGG + Intergenic
1185772411 X:2774495-2774517 GGGCATCCTCACAGCCTCAAGGG + Intronic
1188375306 X:29421352-29421374 CAGGCTCCTCCCCGCTGCAAAGG + Intronic
1189268325 X:39733225-39733247 GAGTCTGGTCCCAGCCTCCATGG - Intergenic
1190384137 X:49868221-49868243 GACCCTCCTCCCAGTATCAAAGG - Intergenic
1190720941 X:53147030-53147052 CAGGTTCTTCCTAGCCTCAATGG - Intergenic
1193205825 X:78746615-78746637 GAGGATCCTCCAAGACTCCAGGG + Intergenic
1195319997 X:103714063-103714085 TAGGGTCCTCACAGCCTCAGTGG + Intronic
1196652135 X:118178651-118178673 CAGGCTCCTCCCACCTGCAAGGG - Intergenic
1197712168 X:129679118-129679140 GGTGCTCCTCCCAGCTTCCAGGG - Intergenic
1200104414 X:153704341-153704363 GAGGCTCTTCCCAGCCCCCCAGG - Intronic
1200785807 Y:7259426-7259448 CAGGCTCCTCCCCGCTGCAAAGG - Intergenic
1201283403 Y:12359973-12359995 ATGGCTCCTCTCAGCCTGAAAGG - Intergenic
1202105214 Y:21356448-21356470 CAGTCTCTTCCTAGCCTCAATGG - Intergenic
1202257397 Y:22936373-22936395 GAGGCCACTCCCAGACTCCACGG - Intergenic
1202410387 Y:24570120-24570142 GAGGCCACTCCCAGACTCCACGG - Intergenic
1202460394 Y:25099952-25099974 GAGGCCACTCCCAGACTCCACGG + Intergenic