ID: 1148484473

View in Genome Browser
Species Human (GRCh38)
Location 17:47981930-47981952
Sequence CTTTATCACCAGAAGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148484473_1148484484 17 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484484 17:47981970-47981992 AATGGTTCAGTAAGGGGCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1148484473_1148484482 10 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484482 17:47981963-47981985 ATCTACAAATGGTTCAGTAAGGG 0: 1
1: 1
2: 1
3: 15
4: 153
1148484473_1148484477 -1 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484477 17:47981952-47981974 GAGGACCCCACATCTACAAATGG 0: 1
1: 0
2: 0
3: 13
4: 123
1148484473_1148484486 22 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484486 17:47981975-47981997 TTCAGTAAGGGGCTCTGGGATGG No data
1148484473_1148484483 11 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484483 17:47981964-47981986 TCTACAAATGGTTCAGTAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1148484473_1148484481 9 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484481 17:47981962-47981984 CATCTACAAATGGTTCAGTAAGG 0: 1
1: 1
2: 1
3: 7
4: 112
1148484473_1148484485 18 Left 1148484473 17:47981930-47981952 CCCCTTTGCTTCTGGTGATAAAG 0: 1
1: 0
2: 3
3: 10
4: 303
Right 1148484485 17:47981971-47981993 ATGGTTCAGTAAGGGGCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148484473 Original CRISPR CTTTATCACCAGAAGCAAAG GGG (reversed) Intergenic
901613469 1:10518163-10518185 GTTTTTGACAAGAAGCAAAGAGG - Intronic
902115476 1:14117513-14117535 CTTTATCAGCAGCATGAAAGTGG + Intergenic
902165527 1:14568352-14568374 CTTTATCAGCAGCATGAAAGCGG - Intergenic
905284757 1:36872003-36872025 CATTTTCACCAGTAGCAAAACGG - Intronic
906188582 1:43880766-43880788 ATGTATTACCAGAAGCAATGCGG + Intronic
909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG + Intergenic
909327894 1:74375499-74375521 ATTTATCCCCAGAAGCAATCTGG - Intronic
911174390 1:94804591-94804613 CTTTATCACCACTAGCAGCGTGG - Intergenic
911307983 1:96254766-96254788 CTTTATCAGCAGCATGAAAGTGG + Intergenic
911468369 1:98283705-98283727 CTTATTTACCAGAAGCAGAGAGG + Intergenic
911939894 1:104031050-104031072 CTTTATCACTAGAATTAAATTGG + Intergenic
912092924 1:106104318-106104340 TTTTAACACAGGAAGCAAAGGGG - Intergenic
916264206 1:162874091-162874113 CCTTATAACCAGAAATAAAGAGG - Intergenic
916732922 1:167582356-167582378 CTTAAATACCAGAAGAAAAGTGG - Intergenic
917368907 1:174266735-174266757 ATTTATTACCAGAGACAAAGAGG - Intronic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
918010565 1:180582833-180582855 CATTATCATCAAAAGTAAAGGGG + Intergenic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
918452520 1:184673293-184673315 TTTTATCCCCAGGAGCAATGTGG - Intergenic
919163606 1:193863661-193863683 CTTTATCAGCAGCATGAAAGCGG + Intergenic
921027744 1:211303264-211303286 CTTTCTCACCAAAAGTAAGGAGG - Intronic
921488671 1:215747248-215747270 CTTTATTACCTGAAACAAAGTGG - Intronic
923144481 1:231188293-231188315 CTTTATCAACATTCGCAAAGTGG + Intronic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923428191 1:233892596-233892618 CTTTATCAACAGCATGAAAGGGG + Intergenic
924182680 1:241454996-241455018 CTTAACCACCAAAGGCAAAGTGG - Intergenic
924632394 1:245753097-245753119 ATGCATCACCAGTAGCAAAGGGG + Intronic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1067124665 10:43506166-43506188 CTTCATCTACAGGAGCAAAGTGG - Intergenic
1067548909 10:47219515-47219537 CTTTGTCAGCAGAAACAAAACGG - Intergenic
1069121226 10:64571919-64571941 CTTGATCACCAGAAATAAAATGG - Intergenic
1070407587 10:76110824-76110846 CTTTATCAGCAGCATCAAAATGG + Intronic
1070479016 10:76862912-76862934 CATTATTAACAGAAGCAAAATGG - Intergenic
1071983072 10:91023269-91023291 CGTCATCACCAGAAGGACAGGGG + Intergenic
1072797348 10:98366062-98366084 CTTTATCCCCAAATGAAAAGGGG + Intergenic
1073340506 10:102740814-102740836 CTTTATTTCCAAAAGCAAATAGG + Exonic
1074598508 10:114889571-114889593 CTTAACCACCAGAAGCCAGGAGG - Intronic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1075661385 10:124199412-124199434 CTTTCTTACCAGAAGCAATAAGG + Intergenic
1076263190 10:129088119-129088141 CTTATTCACCAGAATGAAAGGGG + Intergenic
1078002871 11:7512193-7512215 CTGGCTCACAAGAAGCAAAGTGG - Intergenic
1079632427 11:22694314-22694336 CTTAATTTCCAGAGGCAAAGTGG - Intronic
1079720815 11:23811466-23811488 CCATATCACCAGAAGCAAAGAGG - Intergenic
1079746669 11:24140657-24140679 ATTTTCCACCAAAAGCAAAGTGG + Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1082181028 11:49119845-49119867 CTTTATCCAAAGAAGGAAAGTGG - Intergenic
1085206765 11:74738657-74738679 CATTATAACAAGAAGCAGAGTGG - Intergenic
1086684461 11:89715027-89715049 CTTTATCCAAAGAAGGAAAGTGG + Intronic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1088778189 11:113107451-113107473 CTTTATCACCAGCATGAAAAGGG - Intronic
1089500388 11:118928590-118928612 CTCTATCACCTAAAGCAAATAGG + Intronic
1089718577 11:120389393-120389415 CTATAAAACTAGAAGCAAAGAGG - Intronic
1090164699 11:124534829-124534851 TTTTATCACTAAAAGCAGAGAGG + Intergenic
1092522183 12:9286526-9286548 CTTTAACACATGAAGGAAAGGGG - Intergenic
1092545098 12:9445330-9445352 CTTTAACACATGAAGGAAAGGGG + Intergenic
1092674357 12:10900052-10900074 CTTTATTTCAAGAAGGAAAGTGG + Intronic
1093207219 12:16264920-16264942 CTTTATCAGCAGCATGAAAGTGG + Intronic
1093211363 12:16313037-16313059 CTTTATCAGCAGCAGTAAAATGG + Intergenic
1093505076 12:19855676-19855698 CTTTTTACCCAGAAGGAAAGTGG - Intergenic
1094507850 12:31076720-31076742 CTTTAACACATGAAGGAAAGGGG - Intronic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1096571880 12:52528117-52528139 CAGTATCACCAAAAGCAACGAGG - Intergenic
1097633701 12:62096105-62096127 CATTATCAAGGGAAGCAAAGGGG + Intronic
1097711662 12:62923989-62924011 TTTTAAAACCAGAAGCATAGAGG - Intronic
1098745515 12:74232791-74232813 CTCAACCACCAAAAGCAAAGTGG + Intergenic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1104908564 12:132228523-132228545 CTGTCTCGCCAGAGGCAAAGAGG - Intronic
1106639803 13:31572272-31572294 CTTCATCATCAGAAGCAAGCTGG + Intergenic
1106788899 13:33134638-33134660 ATTTATCAACAGAACCAAATGGG + Intronic
1107991686 13:45824372-45824394 CTTTATCGACAGCAGCAAGGGGG - Intronic
1109233281 13:59784901-59784923 CTCTATAACCAGAATCATAGAGG - Intronic
1109927613 13:69166490-69166512 CTTTATAAAAAGAACCAAAGAGG + Intergenic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1111527456 13:89491427-89491449 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1113375651 13:109763038-109763060 CTTTCACACCATAAGCAGAGTGG + Intronic
1115251380 14:31351982-31352004 TTTTCTCACCAGTAGCAGAGTGG - Intronic
1115822170 14:37224349-37224371 CTTTATCAGCAGCATGAAAGTGG - Intronic
1116530770 14:45970526-45970548 CTTTATCACCAAAGACAAGGTGG + Intergenic
1116639199 14:47439536-47439558 CTGAATCACCACAAGCATAGAGG - Intronic
1118556093 14:67024423-67024445 CTTTATCAAGAGAAGTACAGGGG + Intronic
1119216177 14:72870922-72870944 CTTTATCAGCAGCATGAAAGTGG - Intronic
1119454764 14:74745397-74745419 CTTTATCACCAGCATGAAAACGG - Intergenic
1120048410 14:79835749-79835771 ATTTATCTTCATAAGCAAAGTGG + Intronic
1120484994 14:85102319-85102341 CTTTATCACCAGCATGAAAACGG - Intergenic
1121006574 14:90494492-90494514 TTTTATCATCAGAAACAAGGTGG - Intergenic
1122336302 14:100989477-100989499 CTATATCACCATAGCCAAAGAGG - Intergenic
1123632172 15:22269015-22269037 ATTTCTGATCAGAAGCAAAGTGG - Intergenic
1124146234 15:27127928-27127950 CTTTATCACCAGCACCCACGTGG - Intronic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1129290242 15:74560912-74560934 ATATATCACCGGTAGCAAAGCGG - Intronic
1129650515 15:77484073-77484095 CTTTAACAGCATAAGTAAAGAGG + Exonic
1130756052 15:86764708-86764730 CTTTAGCATCTGAGGCAAAGTGG - Intronic
1130862714 15:87905295-87905317 CTTTATCACAAAAAGAAAACTGG + Intronic
1131678280 15:94694203-94694225 ATTTATCACGAAAAGAAAAGGGG - Intergenic
1133263709 16:4570039-4570061 CTTTTTCTCCAGAAGTGAAGCGG + Intronic
1133867980 16:9661559-9661581 GTTTGTCTGCAGAAGCAAAGAGG + Intergenic
1133952995 16:10413492-10413514 CTTTATCACCAGCATGAAAATGG + Intronic
1134784049 16:16924829-16924851 CTTAATCACCAAAGGCAACGTGG - Intergenic
1135988565 16:27202826-27202848 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1138790906 16:59902936-59902958 CCTTATTCCCAGGAGCAAAGTGG + Intergenic
1140681470 16:77389296-77389318 CTTTATCTCAAAAAACAAAGAGG + Intronic
1140712072 16:77687945-77687967 CATTATTACCACAAGCACAGAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141970805 16:87481354-87481376 ATTTCTAATCAGAAGCAAAGTGG + Intronic
1142347857 16:89565508-89565530 CTCTGCCACCAGATGCAAAGGGG + Exonic
1144063980 17:11607895-11607917 CTTTATCCCCAGGAGCAGAATGG + Intronic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1150180871 17:63119712-63119734 TTTTATTAACAGTAGCAAAGAGG + Intronic
1150972654 17:70046777-70046799 CTGTATAACCAAAAGCTAAGAGG - Intergenic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1153352981 18:4102204-4102226 CTTAATCACCAGAATGACAGAGG - Intronic
1153360347 18:4188114-4188136 TTTTATCACCAAAAACAAGGAGG - Intronic
1153619252 18:6961682-6961704 CTTTGTCACCAGAATCAGAATGG - Exonic
1155676192 18:28431884-28431906 CTCTATCACCAGAATGGAAGAGG - Intergenic
1156057157 18:33020535-33020557 CTTTAAAAACAAAAGCAAAGTGG - Intronic
1156728070 18:40154445-40154467 CTTTATGACCAGTAGCATTGAGG + Intergenic
1158206044 18:54993996-54994018 ATTTACCACAAGAGGCAAAGGGG + Intergenic
1159069866 18:63611681-63611703 CTTTTTCACTAGAAGTATAGAGG + Intergenic
1160139003 18:76302524-76302546 CTGTTGCACCAGAAGGAAAGGGG + Intergenic
1162265126 19:9566748-9566770 CTCTATGAACAGAAGCAATGTGG - Exonic
1162381003 19:10331948-10331970 CTTTATCAGCAGGAGGAAATTGG - Intronic
1162543829 19:11315807-11315829 CTTGATAAACAGCAGCAAAGTGG - Intronic
1164974867 19:32565119-32565141 CTTTAGCACCCTAAGCCAAGTGG + Intergenic
1166237073 19:41464396-41464418 CTTAATATCCAGAAGGAAAGAGG - Intergenic
925151975 2:1621103-1621125 CTTTATCAGCAGCATGAAAGTGG + Intergenic
925474929 2:4202902-4202924 CTTTATCACACGTAGCAAAATGG + Intergenic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
925558826 2:5165333-5165355 CTAAATTACCAGAAGCAATGGGG - Intergenic
926307322 2:11647759-11647781 CTTTATCACCAGCATGAAAATGG + Intergenic
926697791 2:15782764-15782786 CTATATCATCAGAGGCAACGGGG + Intergenic
928942324 2:36739254-36739276 CTTGTTCTCCAGAAGCAATGTGG + Intronic
930254845 2:49078092-49078114 CTTTATCAGCAGCATGAAAGTGG - Intronic
932079359 2:68697670-68697692 CGTTATCCCCAGGAGCAATGTGG + Intronic
933889194 2:86750843-86750865 TTTCAACAGCAGAAGCAAAGTGG - Intronic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
935029049 2:99304459-99304481 CTTTATCAGCAGCATGAAAGTGG + Intronic
935625763 2:105171197-105171219 CTTTATCAGCAGCATCAAAACGG - Intergenic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
936598063 2:113868347-113868369 CTTTGAAACCATAAGCAAAGAGG + Intergenic
937257510 2:120565511-120565533 CTTTGGCACCAGAAGCACGGGGG + Intergenic
938620812 2:133050877-133050899 TTTTATCACCAAAAAGAAAGAGG + Intronic
938974755 2:136465578-136465600 CTTTCTCACCTCAAACAAAGAGG + Intergenic
939506960 2:143057285-143057307 GTTGATCACCAGGACCAAAGGGG - Intergenic
939752542 2:146064940-146064962 CTTTATCACCAGCATGAAAAAGG - Intergenic
940384269 2:153052118-153052140 TTTTATCATCAGAAGAGAAGGGG + Intergenic
940501849 2:154503620-154503642 CTTTATCAGCAGAATAAAAAGGG + Intergenic
942217320 2:173734120-173734142 CTTTAATACCTGCAGCAAAGTGG - Intergenic
942950259 2:181713311-181713333 CTTTATCAACAGAATGAAAATGG + Intergenic
943386851 2:187211654-187211676 CTTTATCACCAGCAAGAAAATGG + Intergenic
943786784 2:191886163-191886185 CTTCATCACCAACAGCAGAGGGG - Intergenic
947541410 2:230982311-230982333 CTTTGCCTCCAAAAGCAAAGTGG + Intergenic
948302408 2:236917655-236917677 TGTTATCCCCAGAAGCAATGTGG + Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1171465899 20:25327787-25327809 TTTTATCACCAGGAGCAATTTGG - Intronic
1172379938 20:34481524-34481546 CTTTATCAGCAGCAGGAAAGTGG - Intronic
1172582957 20:36063265-36063287 CATAGTCAGCAGAAGCAAAGAGG + Intergenic
1173386097 20:42589285-42589307 CTTTATCTGGAGAATCAAAGAGG + Intronic
1174215924 20:48916276-48916298 TTTTATCACCAGTTCCAAAGTGG - Intergenic
1176910191 21:14555961-14555983 TTTATTCCCCAGAAGCAAAGAGG + Intronic
1178110218 21:29362861-29362883 CTTCATCCCCAGAAGCTAGGAGG + Intronic
1179353752 21:40639139-40639161 CTTTATCATCAGACACAAAATGG - Intronic
1183081885 22:35462098-35462120 GTTTATAATCAGAAGCAAATGGG - Intergenic
953592025 3:44267162-44267184 CTATATCACCAAAAGCCAACAGG - Intronic
953995501 3:47516476-47516498 CTTTAGTACCAGAAGGCAAGAGG + Intergenic
954020293 3:47734795-47734817 CTCTGTCACCAGGAGCACAGTGG + Intronic
954403944 3:50334715-50334737 GTTCATCACCAGAAGGGAAGGGG - Intronic
955604758 3:60689288-60689310 CTTTATCAGCAGCAGTAAAAAGG + Intronic
957251107 3:77772133-77772155 CTTTATCAACAGAATGAAAATGG - Intergenic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
957782255 3:84834691-84834713 CTTTATCACCGCAAGCCAAGAGG + Intergenic
959266945 3:104153945-104153967 CTATATCAACAAAAGCAAAAAGG - Intergenic
959345459 3:105189087-105189109 CTTTTCCTCCAGAGGCAAAGGGG + Intergenic
959492166 3:107003187-107003209 CATTTTAACCAGAAGCAAAAAGG - Intergenic
959739337 3:109698034-109698056 CTTTATTAACTGAAGAAAAGTGG + Intergenic
959947862 3:112146042-112146064 CTTTATCAGCAGCAGAAAAACGG + Intronic
960033242 3:113076911-113076933 CTTTATCACCAGAAACAAGGTGG + Intergenic
961369788 3:126422407-126422429 CCTGATCCCCAGAAGCAGAGAGG - Intronic
969109525 4:4834716-4834738 CTTTATCACCAGCATGAAAATGG - Intergenic
969852304 4:9969570-9969592 CTTTATCAGCAGCATCAAAAGGG - Intronic
970656418 4:18235324-18235346 CCTTACCATCAGAAGCCAAGTGG + Intergenic
971742089 4:30534086-30534108 CTTTATCAGCAGCATGAAAGTGG + Intergenic
973035068 4:45396325-45396347 CTTTATCAGCAGAATTAAAATGG - Intergenic
973739426 4:53904812-53904834 TTTTATCACCAGACTCAAGGAGG - Intronic
975293498 4:72705373-72705395 TGTTATCCCCAGAAGCAATGTGG - Intergenic
975538446 4:75477069-75477091 CTCTATCACAAGCAGCAAAAGGG + Intergenic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
978134471 4:105240588-105240610 CTTAATAACCACACGCAAAGAGG - Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
978265987 4:106824469-106824491 CGGAATCACCAAAAGCAAAGGGG + Intergenic
979123055 4:116927052-116927074 CTGTATTACCTGAAGCACAGGGG - Intergenic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
979420410 4:120498253-120498275 CATTATCACAAGAAGGGAAGGGG - Intergenic
979464493 4:121021246-121021268 CTTTATCAGCAGCATGAAAGTGG - Intergenic
979553340 4:122016354-122016376 ATATCTCACCAGAAGAAAAGGGG + Intergenic
983514718 4:168644046-168644068 CTTCATCACTGGAAGCAAATGGG - Intronic
984185055 4:176533552-176533574 CTCTATCACCAAAAGCAAGATGG + Intergenic
985331610 4:188843551-188843573 GTTGATCAACAGAAGCAAACAGG - Intergenic
986057519 5:4153509-4153531 CTTTATCTACTGAAGCAAATGGG - Intergenic
986697129 5:10367484-10367506 ATTTAACACCAGAAGGTAAGTGG + Intronic
987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG + Intronic
987666192 5:20943839-20943861 CTATATCACCCTAAACAAAGTGG - Intergenic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
988756493 5:34258327-34258349 CTATATCACCCTAAACAAAGTGG + Intergenic
991020853 5:61978542-61978564 TTTGCTCACCAGAAGCAAAATGG + Intergenic
991210152 5:64095069-64095091 GATTATCTCCAAAAGCAAAGAGG + Intergenic
993030046 5:82695160-82695182 CTTGATCAGCAGATGCAAACAGG + Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994074042 5:95631147-95631169 CTTCATCACAAGAAAAAAAGGGG - Intergenic
995078311 5:108014737-108014759 CTTTATCAGCAGCATGAAAGCGG - Intronic
995280132 5:110325325-110325347 CTTTGACACCAGCAGCATAGTGG + Intronic
995880939 5:116844261-116844283 GTTTAACACCAGAAGCAGATAGG + Intergenic
995920657 5:117306648-117306670 CTTCAACACCAGCAGCAAAGAGG + Intergenic
996183535 5:120449779-120449801 CTTAATCATTAGAAGTAAAGTGG + Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
998805535 5:145914759-145914781 CCTTCTCACCAGCAGCAGAGTGG + Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1001795388 5:174498110-174498132 CTTTATCAGCAGCATAAAAGTGG + Intergenic
1003128505 6:3375488-3375510 CTTTATTGCCAGAATCAATGTGG + Intronic
1003900334 6:10649265-10649287 TTATATCACCATAAGAAAAGAGG + Intergenic
1003952283 6:11127464-11127486 CTTTATCAGCAGCATGAAAGTGG - Intronic
1004754716 6:18599528-18599550 CTATTTCACCAGAAGCTATGGGG + Intergenic
1005002681 6:21258929-21258951 CTTTACCACCAGAACAAAATTGG + Intergenic
1005502299 6:26439586-26439608 CTTTATCACCAAGAAGAAAGGGG + Intergenic
1005856868 6:29869443-29869465 CTTTATCTCCTGTAGCAAAAGGG + Intergenic
1006789505 6:36690334-36690356 CTTAATCATCAGAGGCAAGGTGG - Intergenic
1008930334 6:56932391-56932413 CTTTATCAGCAGAATGGAAGTGG + Intronic
1009368081 6:62871264-62871286 CTTAATATCCAGAAGGAAAGAGG + Intergenic
1009483487 6:64191154-64191176 CTTTAACACCATAAAGAAAGTGG - Intronic
1010305519 6:74316936-74316958 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1010890020 6:81295417-81295439 CTTAATCATCAGAATAAAAGTGG - Intergenic
1011432056 6:87297982-87298004 CTCTGTCACCAGAATTAAAGAGG + Intronic
1011876630 6:91970720-91970742 CTTTATCAGCAGAGTAAAAGTGG - Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1012277795 6:97294869-97294891 CCTTATCACAAGAAACTAAGTGG - Intergenic
1012686786 6:102260414-102260436 CTTAATCACCAGAAGCCGGGAGG - Intergenic
1013024426 6:106256189-106256211 CTTTCTCTCCAGAAGCATAAAGG - Intronic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013426123 6:110014242-110014264 CTTTGTCACAAAAAGCAAACAGG - Intergenic
1013589929 6:111611379-111611401 CTTTATCAGCAGCATCAAAATGG - Intergenic
1014327706 6:120019254-120019276 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1014775992 6:125510616-125510638 CTTGACCATCAGAAGCAAGGTGG + Intergenic
1015718081 6:136212510-136212532 CTTTATTATCAATAGCAAAGTGG + Intergenic
1016437437 6:144051590-144051612 CTTTATCAGCAGCATGAAAGAGG - Intronic
1016544058 6:145200933-145200955 CTTTCTACCTAGAAGCAAAGAGG - Intergenic
1018031902 6:159848056-159848078 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1018216741 6:161535714-161535736 CTTTTCAACCAGAAACAAAGGGG - Intronic
1018381453 6:163261491-163261513 CATTATCACCAGCAGCAATTTGG + Intronic
1018404437 6:163463498-163463520 ATTTGACACCAGCAGCAAAGGGG + Intronic
1018485936 6:164241220-164241242 CTTTATCAGCAGAATGAAAGTGG - Intergenic
1018492228 6:164305633-164305655 CTTTATCAACAGAAGATAGGAGG - Intergenic
1021170497 7:17393519-17393541 CTTTATCAGCAGCAGCAACATGG - Intergenic
1023298744 7:38744826-38744848 ATTTTTCAACAGAGGCAAAGAGG + Intronic
1024424859 7:49213511-49213533 CTTTATCAGCAGAGTGAAAGTGG - Intergenic
1024695654 7:51854222-51854244 CTCCATCACCTGTAGCAAAGTGG - Intergenic
1027418688 7:77998867-77998889 GTTTATGCACAGAAGCAAAGAGG + Intergenic
1027557328 7:79681904-79681926 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028795032 7:94893041-94893063 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1030195716 7:106851640-106851662 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1031237520 7:119196216-119196238 CTTTAACACAAGAAGAAAAATGG + Intergenic
1033129975 7:138737461-138737483 CTTTATCACCAGCATGAAAAGGG + Intronic
1034754736 7:153605785-153605807 CTTAACCATCAGCAGCAAAGTGG - Intergenic
1035834785 8:2738120-2738142 ATTTCTCACCAGAAGCAATAGGG + Intergenic
1036464173 8:8980761-8980783 CTTTATCACATGCAGCAATGGGG - Intergenic
1037201284 8:16255739-16255761 ATTTATCACCACAATCAAAGAGG - Intronic
1037528970 8:19756310-19756332 CTTTGAAACCAGAAGAAAAGTGG + Intronic
1038134204 8:24768196-24768218 ATTCATCACGAGAAGCCAAGAGG + Intergenic
1038786154 8:30618358-30618380 CTTCATCACTAGTAGTAAAGTGG + Intronic
1040992612 8:53368828-53368850 CTTTGATACCAGGAGCAAAGTGG + Intergenic
1041974713 8:63784354-63784376 CTTTATCATGCAAAGCAAAGTGG - Intergenic
1043101810 8:76056682-76056704 CTTTCCCAAAAGAAGCAAAGAGG + Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044488281 8:92779631-92779653 CTTTATTGCCAGAAGATAAGAGG + Intergenic
1044524101 8:93232123-93232145 ATTTGTCACCAGAAGCAAAATGG + Intergenic
1044760547 8:95513461-95513483 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1044927046 8:97218335-97218357 CACTATCACGAGAAGCAAGGGGG + Intergenic
1045258985 8:100555306-100555328 ATTCTACACCAGAAGCAAAGAGG + Intronic
1045588023 8:103561777-103561799 CTTTATCACCCGAATGAAAATGG - Intronic
1045814370 8:106262237-106262259 TTTAATCACCAGAATCAAGGTGG - Intergenic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1050099259 9:2100808-2100830 CTTTATCAGCAGCATCAAACTGG - Intronic
1050260254 9:3834208-3834230 CTTTATCATCATTAGCAAAAGGG - Intronic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1051762755 9:20485822-20485844 ATTTCTTACCAGAAGCAAATTGG + Intronic
1052577063 9:30304195-30304217 CTCAACCACCAGAGGCAAAGTGG + Intergenic
1055083279 9:72289339-72289361 CTTTATCAGCAGTATGAAAGTGG - Intergenic
1055766542 9:79669666-79669688 TTTTGTCACCAGTAGCAGAGGGG - Intronic
1059766394 9:117387728-117387750 ATTTCTCTCCAGAAACAAAGAGG - Intronic
1061289315 9:129641808-129641830 CTTTATCACCACAAGCCGGGCGG - Intronic
1188508836 X:30912003-30912025 GTTGATCACCAGAAGCCATGGGG + Intronic
1188540172 X:31241094-31241116 CTTTATAACAAGAAGTACAGGGG - Intronic
1189192390 X:39121867-39121889 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189371167 X:40430680-40430702 CTTTATCAGCAGCATCAAAACGG + Intergenic
1189464607 X:41268882-41268904 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189904928 X:45748437-45748459 ATTTATCACCAAGAGAAAAGTGG + Intergenic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1192789644 X:74368778-74368800 CTGTATGTCTAGAAGCAAAGAGG + Intergenic
1193320282 X:80113973-80113995 CTTTATCAGCAGCAAGAAAGTGG + Intergenic
1193449341 X:81646401-81646423 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG + Intergenic
1194300746 X:92182832-92182854 CTTTATCAGCAGCATGAAAGTGG + Intronic
1194455351 X:94096180-94096202 CTTAATCTCCAGAAGCTATGAGG - Intergenic
1194506056 X:94735252-94735274 CTTTATCACCAGCATGAAAACGG - Intergenic
1195033452 X:100948816-100948838 CTATCTCCCCAGTAGCAAAGAGG + Intergenic
1199015233 X:142807170-142807192 CTTTATCAGCAGCATCAAAATGG - Intergenic
1199249692 X:145646340-145646362 CACTACCACCAGAAGCCAAGAGG - Intergenic
1200929536 Y:8684630-8684652 CTTTAATACCAGAAGCCAAATGG - Intergenic
1201233288 Y:11886656-11886678 TGTTATCCCCAGAAGCAATGTGG - Intergenic