ID: 1148488844

View in Genome Browser
Species Human (GRCh38)
Location 17:48010150-48010172
Sequence AACATGACTTCTGCTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148488844_1148488846 26 Left 1148488844 17:48010150-48010172 CCTTTGAGAGCAGAAGTCATGTT No data
Right 1148488846 17:48010199-48010221 TGTAATGCCACATACATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148488844 Original CRISPR AACATGACTTCTGCTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr