ID: 1148489186

View in Genome Browser
Species Human (GRCh38)
Location 17:48012374-48012396
Sequence CCCGGAGGCCGCGGTTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148489177_1148489186 12 Left 1148489177 17:48012339-48012361 CCGCCGCAGACGCGGAGCTGCGC No data
Right 1148489186 17:48012374-48012396 CCCGGAGGCCGCGGTTGCCATGG No data
1148489178_1148489186 9 Left 1148489178 17:48012342-48012364 CCGCAGACGCGGAGCTGCGCCTA No data
Right 1148489186 17:48012374-48012396 CCCGGAGGCCGCGGTTGCCATGG No data
1148489181_1148489186 -10 Left 1148489181 17:48012361-48012383 CCTAGCCGCGCGCCCCGGAGGCC No data
Right 1148489186 17:48012374-48012396 CCCGGAGGCCGCGGTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148489186 Original CRISPR CCCGGAGGCCGCGGTTGCCA TGG Intergenic