ID: 1148495629

View in Genome Browser
Species Human (GRCh38)
Location 17:48051868-48051890
Sequence GTAAACACCCTGGCATGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148495629_1148495635 12 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495635 17:48051903-48051925 AGCGTGACTGCTGGAGGCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 174
1148495629_1148495634 11 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495634 17:48051902-48051924 CAGCGTGACTGCTGGAGGCCTGG 0: 1
1: 0
2: 2
3: 68
4: 1113
1148495629_1148495632 3 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495632 17:48051894-48051916 TTGGATTTCAGCGTGACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
1148495629_1148495640 19 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495640 17:48051910-48051932 CTGCTGGAGGCCTGGGGTGGGGG 0: 1
1: 0
2: 12
3: 173
4: 1306
1148495629_1148495639 18 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495639 17:48051909-48051931 ACTGCTGGAGGCCTGGGGTGGGG 0: 1
1: 0
2: 11
3: 70
4: 623
1148495629_1148495641 22 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495641 17:48051913-48051935 CTGGAGGCCTGGGGTGGGGGAGG 0: 1
1: 4
2: 32
3: 333
4: 2186
1148495629_1148495638 17 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495638 17:48051908-48051930 GACTGCTGGAGGCCTGGGGTGGG 0: 1
1: 0
2: 6
3: 92
4: 1054
1148495629_1148495633 6 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495633 17:48051897-48051919 GATTTCAGCGTGACTGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 155
1148495629_1148495637 16 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495637 17:48051907-48051929 TGACTGCTGGAGGCCTGGGGTGG 0: 1
1: 0
2: 0
3: 45
4: 422
1148495629_1148495636 13 Left 1148495629 17:48051868-48051890 CCTACACATGCCAGGGTGTTTAC 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1148495636 17:48051904-48051926 GCGTGACTGCTGGAGGCCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148495629 Original CRISPR GTAAACACCCTGGCATGTGT AGG (reversed) Intronic
900740260 1:4326838-4326860 GTGCACATCCTGGCATCTGTGGG - Intergenic
900796703 1:4712451-4712473 GTAAACGCCCGGAAATGTGTTGG - Exonic
902509990 1:16961190-16961212 AAAAACACCCTGCCATGTGGGGG - Intronic
907393198 1:54172021-54172043 GTAACCAACCTAGAATGTGTTGG - Intronic
911164872 1:94715503-94715525 GGAAACTTCCTGGCATGTCTGGG + Intergenic
913261117 1:116998988-116999010 GTAAGCACCCTACCATGTGCTGG - Intergenic
914474295 1:148010672-148010694 GGAAACACCAAGGCATGGGTTGG + Intergenic
919287206 1:195579147-195579169 GACACCACCCTGGCATGTGGTGG - Intergenic
922755755 1:228096058-228096080 TGAAACACACAGGCATGTGTGGG + Intronic
1065063329 10:21931702-21931724 GTAAAAACCCTGGTACGTATTGG + Intronic
1067842241 10:49690289-49690311 GTGAACACCCTGGCCCTTGTTGG - Intronic
1068113845 10:52714065-52714087 TTTAACATCCTTGCATGTGTGGG + Intergenic
1068558590 10:58485940-58485962 GTCAACACCAGAGCATGTGTGGG + Intergenic
1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG + Exonic
1070928801 10:80245855-80245877 GGAAACACCCTGACTTTTGTAGG - Intergenic
1074370189 10:112894489-112894511 GTAAAGTGCCTGGCGTGTGTGGG - Intergenic
1076176866 10:128374943-128374965 AGAAGCACCCTGGCCTGTGTTGG - Intergenic
1076701572 10:132275870-132275892 GCAGACACCCAGGCCTGTGTCGG + Intronic
1082218218 11:49600646-49600668 GGAAAGACCCTGGTATGTCTGGG + Intergenic
1086631352 11:89023471-89023493 GGAAAGACCCTGGTATGTCTGGG - Intronic
1087809968 11:102600109-102600131 GTAAACACAATGCCATTTGTTGG + Intronic
1087937393 11:104050636-104050658 GGAAACACCCAGAAATGTGTGGG + Intronic
1089167254 11:116486574-116486596 GTAGACACCCACACATGTGTGGG + Intergenic
1090441167 11:126726772-126726794 CTCAACACATTGGCATGTGTAGG - Intronic
1094177239 12:27553458-27553480 ATACACACCATGACATGTGTTGG + Intronic
1095542886 12:43330903-43330925 GTAAACACTCTGGAATGTGTGGG + Intergenic
1098777151 12:74634929-74634951 CTACAGCCCCTGGCATGTGTGGG - Intergenic
1099995913 12:89778223-89778245 GTAATCAGCCTGGCGTGTGGTGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102624303 12:114222290-114222312 TTAAGCACCCTAGAATGTGTAGG + Intergenic
1104655488 12:130571290-130571312 GGAACCACCCTGGCAGGTCTAGG + Intronic
1104738205 12:131153038-131153060 GTAAACACCACGGCATCTGGGGG - Intergenic
1107780896 13:43901323-43901345 ATCAACACCCTGGCATTAGTAGG - Intergenic
1109430873 13:62233183-62233205 GTACAGACTCTGACATGTGTAGG - Intergenic
1117117953 14:52535745-52535767 GTAAACACTGAGGTATGTGTTGG + Intronic
1118681526 14:68246381-68246403 GTACAAACCCTGGCATATTTTGG - Intronic
1119893075 14:78197586-78197608 GTAAACAGGCTGGCAAGAGTGGG + Intergenic
1125150684 15:36528475-36528497 TAAGACACCCTGGCATGTGAAGG + Intergenic
1125374824 15:39017196-39017218 GAAAACAATCTTGCATGTGTTGG + Intergenic
1125521572 15:40350746-40350768 GTAAACAGCCTTGCCAGTGTTGG + Intergenic
1128334974 15:66779944-66779966 GGGAGCACCCTGGCCTGTGTTGG + Intronic
1129995842 15:80004301-80004323 GTATTCACCCTGGCATGTGCTGG + Intergenic
1134166233 16:11932091-11932113 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134494485 16:14721634-14721656 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134499866 16:14760754-14760776 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134526412 16:14947373-14947395 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134580713 16:15368296-15368318 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134713989 16:16345846-16345868 GGAAATACCCTGGCCTTTGTAGG - Intergenic
1134721862 16:16389209-16389231 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134832447 16:17334565-17334587 CTAACCACCCAGGAATGTGTAGG + Intronic
1134945563 16:18322660-18322682 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134952828 16:18362812-18362834 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1135135740 16:19884588-19884610 ATAAACTCCCTGGCTTGGGTTGG + Intronic
1135311624 16:21409516-21409538 GGAAATACCCTGGCCTTTGTAGG + Intronic
1135364576 16:21841968-21841990 GGAAATACCCTGGCCTTTGTAGG + Intronic
1135447267 16:22529381-22529403 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136150789 16:28347425-28347447 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136167025 16:28461263-28461285 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136195950 16:28653769-28653791 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136212288 16:28767892-28767914 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136257011 16:29047804-29047826 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136308329 16:29388512-29388534 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136321746 16:29490050-29490072 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136436426 16:30230020-30230042 GGAAATACCCTGGCCTTTGTAGG + Intronic
1139856025 16:69980939-69980961 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1140999588 16:80295966-80295988 GGAAACAGCCTGGCATCTGCTGG + Intergenic
1141234525 16:82203235-82203257 ACTAACACCCTGGTATGTGTGGG - Intergenic
1146479975 17:33197380-33197402 AGAAACACCCTGGAAAGTGTGGG - Intronic
1146685307 17:34837459-34837481 GTAAAAGCCCTGGCATGTTTTGG - Intergenic
1148293870 17:46482494-46482516 GTAAAAACCTAGGCCTGTGTAGG + Intergenic
1148316053 17:46700197-46700219 GTAAAAACCTAGGCCTGTGTAGG + Intronic
1148495629 17:48051868-48051890 GTAAACACCCTGGCATGTGTAGG - Intronic
1153224876 18:2892031-2892053 GTGAAAACGCTGGCATGGGTAGG + Exonic
1154117496 18:11624148-11624170 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1158862674 18:61607876-61607898 GTAGACATCCAGGCAAGTGTAGG - Intergenic
1161136811 19:2624834-2624856 GTAAACACCCTGGAGCCTGTGGG - Intronic
1161253336 19:3293182-3293204 ACAAACACCCTGGCCTGTGCAGG + Intronic
1163679744 19:18674084-18674106 GTAAAAACCCTGACATGAGATGG + Intergenic
1164040977 19:21492482-21492504 GTTAACACCGGGACATGTGTGGG + Intergenic
1168199329 19:54803670-54803692 GTCATCATCCTGGCATGTCTTGG + Exonic
925564075 2:5230524-5230546 CTATTCACCCAGGCATGTGTAGG + Intergenic
925732337 2:6928353-6928375 GTAAACACACAGGCAGGTGGTGG - Intronic
926808264 2:16733317-16733339 GTAATCAACCTGGAATGTGAGGG - Intergenic
930685784 2:54306640-54306662 GTAACCACCCTGGTGTTTGTAGG - Intergenic
934549822 2:95251995-95252017 GGAAAAACCTTGGCCTGTGTTGG + Intronic
941693270 2:168523884-168523906 GCAACCACCATGGCATGTGTGGG - Intronic
942915803 2:181305141-181305163 GTAAAATGCCTGGCATGTGCTGG - Intergenic
943710142 2:191083764-191083786 TCAAACACACTGGCCTGTGTGGG + Intronic
946504836 2:220287735-220287757 GAAAACAGCCTGGGATATGTGGG + Intergenic
947297829 2:228652231-228652253 ATATACATCCTGGCATGTGCAGG - Intergenic
1172216756 20:33241177-33241199 GTGAACACACAGGTATGTGTAGG - Intronic
1183678703 22:39314256-39314278 GTCAGCACACTGGCATGTCTGGG - Intronic
952416278 3:33093821-33093843 GTAAGCACCCAGGCAGGAGTAGG + Exonic
952853275 3:37746633-37746655 AGAAACATCCTGGCATGTCTGGG - Intronic
952958545 3:38575692-38575714 GTGAACAGCCTGGCAGGTCTGGG + Intronic
953593338 3:44282427-44282449 GAACACAGCCTGGCATGTATAGG - Intronic
953847114 3:46436423-46436445 GGAAACACCCTGGCTGGTGAGGG - Intronic
954461193 3:50627914-50627936 GTACTCACCCAGGCCTGTGTGGG + Intronic
959192717 3:103135619-103135641 GTAATCTCACTGACATGTGTAGG - Intergenic
959824629 3:110779004-110779026 GGAAACAGCCTGCCATGTTTAGG + Intergenic
960986303 3:123283278-123283300 GTAAGCACTCTGGAATCTGTGGG + Exonic
961778032 3:129304038-129304060 GTAAACACCATGGCAGGGCTAGG - Intronic
962626955 3:137235325-137235347 ATTAACACCCTAGCATATGTTGG - Intergenic
963020050 3:140864229-140864251 GTAAAGAGCCTGGCACGTGGTGG + Intergenic
968762632 4:2450540-2450562 GTGCCCACCCTGGGATGTGTTGG + Intronic
979962515 4:127037265-127037287 GTATATACCCAGCCATGTGTTGG + Intergenic
980998695 4:139807451-139807473 GTTAACAGGCCGGCATGTGTAGG - Intronic
989120191 5:37997346-37997368 GTAAAGTCCCTGCCATTTGTAGG + Intergenic
990072694 5:51804686-51804708 GTAAATGCCTTAGCATGTGTGGG - Intergenic
992224810 5:74609976-74609998 GTAAACACCCTGCAACGTGTGGG + Intergenic
993357121 5:86928091-86928113 CTAAACATCCTGCAATGTGTGGG - Intergenic
1000870305 5:166569197-166569219 GTTAACTGCCTGGTATGTGTAGG + Intergenic
1001881631 5:175249671-175249693 GGAAAGATCCTGGCATGTTTGGG + Intergenic
1006856632 6:37138064-37138086 GTAAACTCCCTGGGAGGTGGGGG - Intergenic
1011550578 6:88528064-88528086 GTGAGCACGCTGGCATGTGTGGG - Intergenic
1014881943 6:126734301-126734323 GTAAACTCACAGGCATGGGTGGG + Intergenic
1016113182 6:140251324-140251346 GTACCCAACCTGCCATGTGTGGG + Intergenic
1017471387 6:154740263-154740285 GTAAACATCCTGGAATGCATAGG - Intronic
1018593881 6:165457601-165457623 GGAAACACAGTGGCATATGTTGG - Intronic
1022409020 7:30121850-30121872 GTGAACTCCCTGGTATGTGCAGG - Intronic
1025760812 7:64389528-64389550 GGAAATACCCTGGCCTTTGTAGG - Intergenic
1032497791 7:132375797-132375819 GGAAACAGCATGGCATGTGGGGG + Intronic
1034994161 7:155567649-155567671 GTAAACAACTCGGCATGTCTGGG - Intergenic
1035753545 8:2012600-2012622 GTAAACACCCTTGCCAGAGTGGG + Intergenic
1045051681 8:98332966-98332988 GTAAACACCCTTCTGTGTGTAGG + Intergenic
1045329150 8:101140488-101140510 GTAGACAACCTGCGATGTGTGGG + Intergenic
1047538810 8:125744046-125744068 GTAAAGTCACTGGCATGTGCAGG + Intergenic
1047924984 8:129674038-129674060 ATACACACCCTGGCCTGTGGGGG - Intergenic
1050630871 9:7557122-7557144 CTAAATACCCTGCCATGTGCTGG + Intergenic
1052344703 9:27397872-27397894 CTAAACACCCTGCAATGTATGGG - Intronic
1053494813 9:38542375-38542397 GTCAACACCCTGGCTAGTGAGGG + Exonic
1056779046 9:89535730-89535752 GTGACCCCCCTGGCAGGTGTGGG - Intergenic
1061757060 9:132822771-132822793 GTAAACACACTGACCTGGGTTGG + Intronic
1185600108 X:1333233-1333255 ACAAACACCCTGGCATGCTTGGG - Intergenic
1185746870 X:2580707-2580729 ATAACCACCCTTGCATGTGTGGG + Intergenic
1189254436 X:39626987-39627009 GTAAACTCCCTGGCACTTCTAGG - Intergenic
1194000649 X:88424712-88424734 GTACACACCCTGGCAGGGGCAGG + Intergenic
1196301030 X:114050227-114050249 GTAACCAGCCAGGCATGAGTGGG + Intergenic