ID: 1148496264

View in Genome Browser
Species Human (GRCh38)
Location 17:48055023-48055045
Sequence GTGAGAGCTGCGGTCCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148496264_1148496280 30 Left 1148496264 17:48055023-48055045 CCCGCCTGGACCGCAGCTCTCAC 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1148496280 17:48055076-48055098 CCCCTTAACTCTTTGCTGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 124
1148496264_1148496273 0 Left 1148496264 17:48055023-48055045 CCCGCCTGGACCGCAGCTCTCAC 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1148496273 17:48055046-48055068 AGTGGTGGGGGCCATGCCAAAGG 0: 1
1: 0
2: 8
3: 11
4: 203
1148496264_1148496274 7 Left 1148496264 17:48055023-48055045 CCCGCCTGGACCGCAGCTCTCAC 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1148496274 17:48055053-48055075 GGGGCCATGCCAAAGGCAGCCGG 0: 1
1: 0
2: 1
3: 20
4: 231
1148496264_1148496278 26 Left 1148496264 17:48055023-48055045 CCCGCCTGGACCGCAGCTCTCAC 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1148496278 17:48055072-48055094 CCGGCCCCTTAACTCTTTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148496264 Original CRISPR GTGAGAGCTGCGGTCCAGGC GGG (reversed) Intronic
901065029 1:6490407-6490429 GTGGGAGCTGCGCTCCGGACGGG - Intronic
901600431 1:10419435-10419457 GTCAGCACTGGGGTCCAGGCTGG + Exonic
901836359 1:11926324-11926346 GTGGGCGCCGCGGTCCGGGCCGG - Exonic
904585265 1:31576564-31576586 GTGTGGGCTGGGGCCCAGGCTGG - Exonic
904618794 1:31763621-31763643 GTAAGAGGGTCGGTCCAGGCTGG + Intronic
905294211 1:36943952-36943974 GTGAGAGCTTCATTCCAGACAGG + Intronic
906610557 1:47198984-47199006 GTCAGAACTGAGGTCCAGGCTGG + Intergenic
906715346 1:47964742-47964764 GGGAGCTCTGGGGTCCAGGCCGG + Intronic
907930993 1:59000101-59000123 GAGAGAGCTGGTCTCCAGGCAGG + Intergenic
908430613 1:64053267-64053289 GTGAGAGCTGAGGTCCACTGAGG + Intronic
911114835 1:94236850-94236872 GTGAGGGCTGCAGTCAGGGCAGG + Intronic
912277314 1:108273080-108273102 GCGAGTGCTGCGGTGCTGGCTGG + Intergenic
912290914 1:108421276-108421298 GCGAGTGCTGCGGTGCTGGCTGG - Intronic
916997378 1:170315428-170315450 GTGAGAGATGAGGTCCAGAAGGG - Intergenic
918691974 1:187492258-187492280 GTGAGAGCTGTGGAGCAGGCAGG - Intergenic
920651310 1:207839494-207839516 GTGGGTGCTGCGGTCCAGCAGGG + Intergenic
922503355 1:226112299-226112321 TTGAGAGCTGCGGTTCACACAGG + Intergenic
922507424 1:226134633-226134655 GTGAGGGCAGTGGTCCAGGTGGG - Intergenic
924816740 1:247448569-247448591 GAGAGAGCTGCGATCCATCCAGG + Exonic
1063734327 10:8735046-8735068 GGGAGATTTGGGGTCCAGGCTGG + Intergenic
1067848276 10:49739638-49739660 GTGAGGGCTGCGGTGGTGGCTGG - Intronic
1069853676 10:71426546-71426568 GTGAGAGGTGGGGCCCAGGGAGG + Intronic
1071456170 10:85853152-85853174 GTGAGAGCTGGGGAACAGGGAGG - Intronic
1071477795 10:86039635-86039657 GGGCGAGCTGAGGCCCAGGCTGG + Intronic
1073461386 10:103667727-103667749 CTGAGAGCAGAGGTTCAGGCTGG - Intronic
1075320398 10:121486918-121486940 GAGTGAGATGTGGTCCAGGCTGG - Intronic
1075967171 10:126623070-126623092 CTTAGAGCTGCTGGCCAGGCAGG - Intronic
1076348113 10:129794672-129794694 GGGAGAGCCGCGTTCCTGGCTGG + Intergenic
1076401740 10:130189661-130189683 GTGGGATCGGGGGTCCAGGCCGG + Intergenic
1076883884 10:133252499-133252521 GGGAGAGCTGGGGTGCAGGGAGG - Intergenic
1078933470 11:15930870-15930892 GTGAGGGCTGGGGACAAGGCAGG - Intergenic
1079383419 11:19958514-19958536 GTTTGACCTGCAGTCCAGGCTGG + Intronic
1080545493 11:33313870-33313892 TTGAGAGATAGGGTCCAGGCTGG + Intronic
1081507555 11:43734176-43734198 GAGAGAGCTGGTCTCCAGGCAGG + Intronic
1081712613 11:45227031-45227053 GTGCGAGCTGCGGTCCACGGCGG + Intronic
1081730909 11:45371167-45371189 GTCAGGGCTGCGCTCCAGGCAGG - Intergenic
1081879161 11:46433369-46433391 GTGATAGCTCTGGTCCTGGCTGG + Intronic
1082048417 11:47750010-47750032 GTGGGAGCAGCAGTCCAGACAGG - Intronic
1083945134 11:65919259-65919281 GCGGGAGCGGCGGTCCAGACTGG + Exonic
1084078558 11:66802201-66802223 GTGAGATCTGCACTCCAGCCTGG - Intronic
1084086717 11:66858331-66858353 GTTGGAGGTGAGGTCCAGGCGGG - Exonic
1085217158 11:74843149-74843171 GGGAGAGCTGGGGCACAGGCCGG + Exonic
1085385231 11:76153788-76153810 GTGAGAGCAGCAGCCGAGGCTGG - Intergenic
1087068914 11:94055393-94055415 GAGAGAGCTGGTCTCCAGGCAGG - Intronic
1087224824 11:95586752-95586774 GGGAGAGCTGAGCTCCAGGGTGG - Intergenic
1089689883 11:120180685-120180707 GAGAAAGCTGGGGCCCAGGCTGG - Intronic
1089788659 11:120926180-120926202 CTGAGAGCTTAGGTCCAGGCAGG - Intronic
1090094746 11:123731325-123731347 GTTAGAGCAGTAGTCCAGGCAGG - Intronic
1090868811 11:130725186-130725208 GTGGGGGCTGCACTCCAGGCAGG + Intergenic
1091104455 11:132905527-132905549 GTCAGAACTGCTTTCCAGGCTGG - Intronic
1095412633 12:41940744-41940766 CTGAGAGCTGCGGTTTAGCCTGG + Intergenic
1096377452 12:51124966-51124988 GAGAGAGCTGGTCTCCAGGCAGG - Intronic
1099042663 12:77675777-77675799 GTGAGATCTGAGGTCCTGGGAGG + Intergenic
1101253890 12:102958782-102958804 GTGAGCGCCGCCTTCCAGGCAGG + Exonic
1101540395 12:105659695-105659717 GGGAGAGCTGCTGTCAAGCCTGG - Intergenic
1101633844 12:106521126-106521148 GTGGGGGCTCCGGTGCAGGCAGG + Intronic
1104854874 12:131896808-131896830 GTGCAGGCTGTGGTCCAGGCAGG - Intronic
1109347254 13:61129288-61129310 ATGAGAGCTGGCGGCCAGGCAGG + Intergenic
1111721925 13:91956472-91956494 GTGACAGCTGTGGGCCAGGCAGG - Intronic
1112594594 13:100796445-100796467 GTGGCACCTGCTGTCCAGGCTGG + Intergenic
1113325011 13:109272375-109272397 GTGACAGCTGCTGTCCCTGCTGG - Intergenic
1115850541 14:37586468-37586490 GTGAGGGCTGCAGTCCTAGCTGG + Intergenic
1116086089 14:40239848-40239870 GTGAGAACTGCACTCCAGCCAGG - Intergenic
1118994776 14:70825854-70825876 GAGAAAACTGAGGTCCAGGCTGG - Intergenic
1121407038 14:93725363-93725385 TTGGGAGCAGCAGTCCAGGCAGG - Intronic
1122782747 14:104150504-104150526 GTAACAGCTGTGGTCCAGGGTGG - Intronic
1123940409 15:25213973-25213995 GTGAGTGCTTCTGCCCAGGCAGG + Intergenic
1125500775 15:40239267-40239289 GAGACAGCCACGGTCCAGGCAGG + Intronic
1127325030 15:57886483-57886505 GTGAGGGCTGAGTTCCAGGTTGG + Intergenic
1128601761 15:69000959-69000981 CTGAGTGTTGTGGTCCAGGCTGG + Intronic
1129154469 15:73709304-73709326 GTGAGTGGTGGGCTCCAGGCTGG + Intronic
1129154503 15:73709428-73709450 GTGAGTGGTGGGCTCCAGGCTGG + Intronic
1132374765 15:101321706-101321728 GAGGATGCTGCGGTCCAGGCAGG - Intronic
1132562349 16:602094-602116 TTGAGAGCTGTTGCCCAGGCTGG - Intronic
1132867865 16:2102791-2102813 GTGAGCTCTGCGGGCCAGCCTGG - Intronic
1134021467 16:10924099-10924121 GTGGCAGCTGCGGTCCACCCAGG + Exonic
1134452186 16:14370334-14370356 ATGGGAGCTGCTGACCAGGCTGG + Intergenic
1135561542 16:23480437-23480459 GTCAAAGCTGGGGTCCAGCCCGG + Intronic
1136175241 16:28512153-28512175 GAGAGAGCTGCGCTCCAGACTGG - Intergenic
1136394381 16:29985173-29985195 GTGAGAGCTGGGGCTCAGCCTGG - Intronic
1136395401 16:29989806-29989828 GTGAGGCCTGGGGTCCAGGGAGG + Intronic
1137401073 16:48155014-48155036 AGGAGAGGTGCGGTGCAGGCAGG - Intronic
1139591474 16:67935630-67935652 CGTAGAGCTGCGGTCCAGTCAGG + Exonic
1141185708 16:81785590-81785612 GTGAGAGGTGGGAGCCAGGCTGG + Intronic
1141239491 16:82252038-82252060 GTGAGAGCTGGGGAGCAAGCTGG - Intergenic
1141553552 16:84821951-84821973 GGTAGAGCTGCCGTCCAGGCTGG + Intronic
1141664163 16:85457345-85457367 CTGACAGCTGCGGTCCAGTCTGG - Intergenic
1141686801 16:85574876-85574898 TTGGGATCTGCGCTCCAGGCAGG + Intergenic
1143672821 17:8408259-8408281 GTGAGAGCTGGCGCCCACGCAGG + Intergenic
1144204505 17:12970155-12970177 GAGAGAGCAGTGGTCCAGCCTGG + Intronic
1146042138 17:29466171-29466193 GACAGAGTTGCTGTCCAGGCTGG + Intronic
1147994212 17:44352444-44352466 GTGAGGGCTACGGGCCAGGAAGG - Exonic
1148127245 17:45243170-45243192 GAGAGCGCTGAGGTCCAGGCTGG - Exonic
1148496264 17:48055023-48055045 GTGAGAGCTGCGGTCCAGGCGGG - Intronic
1148670867 17:49409104-49409126 GAGAGAGCTGGTCTCCAGGCAGG - Exonic
1148748678 17:49932236-49932258 GGGAGCGCTGGGGGCCAGGCCGG - Intergenic
1150621350 17:66809904-66809926 GAGAGACCTGGGGACCAGGCGGG - Exonic
1152523165 17:80872380-80872402 GGGAGAACTGCGGACCAGGAAGG + Intronic
1152648732 17:81482213-81482235 GAGAGGGCTGTGGTCCGGGCAGG + Intergenic
1152682655 17:81677100-81677122 GTGGCAGCTGGGTTCCAGGCAGG - Intergenic
1152927618 17:83094622-83094644 GTGGGCGCTGCGGTCCTGGTGGG + Exonic
1155501474 18:26491281-26491303 TTGAGGGCTGCTCTCCAGGCTGG - Intronic
1155957111 18:31963397-31963419 GTCAGCACTGGGGTCCAGGCTGG + Intergenic
1156452749 18:37275703-37275725 GTGATAAGTGCGCTCCAGGCAGG - Intronic
1160213747 18:76907607-76907629 GTGTGAGCTGCGCGCCTGGCCGG + Intronic
1160776844 19:860536-860558 GTGAGAGCTGGGATCCCGTCAGG + Intronic
1160800953 19:968525-968547 GGGAGAGGCGAGGTCCAGGCAGG - Intronic
1160824696 19:1074242-1074264 GTGAGAGCTGGTGTCCCAGCAGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161086533 19:2338101-2338123 TTGAGAGCTGGGGGCCTGGCAGG + Intronic
1161587629 19:5114118-5114140 GTGAGGGCTCCGGCTCAGGCAGG - Intronic
1162812720 19:13174076-13174098 GTCAGAGTTCCGGTCCAGCCTGG - Intergenic
1163155372 19:15437251-15437273 CTGAGAGCTGAGGAGCAGGCAGG - Intronic
1163686912 19:18716953-18716975 GTGGGAGCTGGCGTGCAGGCAGG + Intronic
1164649161 19:29879644-29879666 CTGAGAGCTGAGAACCAGGCAGG - Intergenic
1165495703 19:36151123-36151145 ACTAGAGCTGGGGTCCAGGCTGG - Intronic
1167798468 19:51726046-51726068 GGGAGAGCTCCGGGACAGGCTGG - Intergenic
1168155383 19:54471378-54471400 GTGGGAGCTGCGGTGCAGCCGGG + Intronic
1168543329 19:57230881-57230903 TGGAGTGCTGCGGTCCGGGCTGG - Intronic
925345378 2:3168499-3168521 GTGAGTGCTCTGGTTCAGGCAGG - Intergenic
925607531 2:5673699-5673721 CAGAGAACTGTGGTCCAGGCAGG + Intergenic
925609631 2:5692495-5692517 GTGGGAGCTGCGGTCGCGACAGG - Intergenic
927141654 2:20135159-20135181 GTGGGAGCTGGCATCCAGGCAGG - Intergenic
927181388 2:20448608-20448630 GTGAGCGCTCTGGCCCAGGCTGG + Exonic
927496189 2:23553472-23553494 GTGAGGCCTTGGGTCCAGGCTGG + Intronic
927884146 2:26708163-26708185 GGGAGAGCTGCCTTCCAGGAGGG + Intronic
928465980 2:31522799-31522821 CTGTGAGCTGAGGTCCATGCAGG - Exonic
932468473 2:71938966-71938988 GTGAGAGCCGAGGTCCCTGCTGG - Intergenic
932775943 2:74528526-74528548 GTGTGAGCTGCTGACTAGGCTGG - Intronic
934078870 2:88451457-88451479 GGGAGAACTGGGGTCCAGCCCGG - Intronic
935177297 2:100661017-100661039 GTGAGGGCTGCCTTCCTGGCTGG - Intergenic
938226520 2:129621213-129621235 GTCAGAGGTGCTGGCCAGGCAGG + Intergenic
942244929 2:173999159-173999181 GTGATAGCAGCAGTCCAGCCCGG + Intergenic
946084548 2:217157607-217157629 TTCAGAGCTGCTGGCCAGGCAGG + Intergenic
948247365 2:236498148-236498170 GTGAGAAATGAGGTGCAGGCTGG + Intronic
948592381 2:239059787-239059809 AGGAGAGCTGTGCTCCAGGCTGG - Intronic
948861444 2:240754611-240754633 GTGAGACCTGCGGCCCTGGAGGG - Intronic
948990360 2:241550926-241550948 GTGAGAGCTGCTGTCAGGGCAGG - Intergenic
1169044415 20:2524632-2524654 GGGAGAGCTGCGGGCCCCGCCGG + Intronic
1169218235 20:3805502-3805524 GTAAGAGCTTCTGTTCAGGCTGG - Exonic
1171012188 20:21514858-21514880 GAGAGAGCTCCGCTCCGGGCCGG + Intergenic
1171872194 20:30537666-30537688 GAGAGGGGCGCGGTCCAGGCGGG - Intergenic
1172315712 20:33952636-33952658 GTGAGAGCTGAGGTCTAGTGAGG - Intergenic
1173727659 20:45308462-45308484 GGGCTAGCTGCGGGCCAGGCTGG + Intronic
1174391608 20:50221407-50221429 GAAAGAGCTGAGGTCCAGGGAGG + Intergenic
1175367157 20:58463688-58463710 CTTAGAGTTGCAGTCCAGGCAGG + Intronic
1178234094 21:30821788-30821810 GGGAGGGCTGGGGTGCAGGCAGG + Intergenic
1180999025 22:19979387-19979409 GTGAGAGCTGAGGGACAGGTAGG - Intronic
1181052835 22:20245873-20245895 GTGAGAGCTGGGGCCATGGCAGG - Intronic
1181107305 22:20582796-20582818 ATGTGAGCCGGGGTCCAGGCAGG - Intronic
1181278049 22:21699140-21699162 CCCAGACCTGCGGTCCAGGCAGG - Exonic
1182285733 22:29245770-29245792 GTGAGAGCTTTGATCCAGGTGGG - Intronic
1183061020 22:35336466-35336488 GTGCCAGCTGTGGTCAAGGCTGG - Intronic
1183826145 22:40389301-40389323 GTAAGAACTGCAGTGCAGGCCGG + Intronic
1184556824 22:45237837-45237859 GTGAGAGGTGCGCTCCACTCTGG + Intronic
1184676252 22:46044974-46044996 GAGCGCGCCGCGGTCCAGGCGGG - Intergenic
954306324 3:49727383-49727405 CTCAGACCGGCGGTCCAGGCAGG + Exonic
954819545 3:53313772-53313794 ATGAGAGCTCCTGTGCAGGCTGG - Intronic
955226194 3:57062399-57062421 GTGGGGGCTGTGGTCCTGGCTGG - Intronic
960047550 3:113212191-113212213 CTGGGAGCTGCGGCCGAGGCTGG + Intronic
961487305 3:127226038-127226060 GTGACAGCTGTGAGCCAGGCTGG + Intergenic
961830020 3:129618602-129618624 GTGGGAGGGGAGGTCCAGGCGGG - Intergenic
963453913 3:145519612-145519634 GTGAGAGCTGAGGTTCAATCAGG + Intergenic
963668506 3:148221704-148221726 GCAAGAGCTGGGGTCCAGGAAGG - Intergenic
965768223 3:172153801-172153823 GTGAAGGCTGCAGTCCAGTCTGG - Intronic
967484600 3:190015820-190015842 GGCAGAGCTTCAGTCCAGGCAGG - Intronic
968088037 3:195882969-195882991 GTGTCTGCTGCGGTCCAGTCCGG - Intronic
968562094 4:1289597-1289619 GTGCGGGCTGCGGCCCGGGCGGG - Intergenic
969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG + Intronic
969302179 4:6303642-6303664 GTGGGGGCTGCTGTCCATGCGGG + Intergenic
969303394 4:6310540-6310562 GAGAGACCTGCGTTCCAGCCTGG + Intergenic
969532995 4:7739952-7739974 CTGAGAGGTGAGGCCCAGGCCGG - Intronic
969681620 4:8646341-8646363 GTGACAGCTGAGGCCGAGGCTGG + Intergenic
970394965 4:15655926-15655948 CTGAGAGCTTCGGTCCCGGGCGG + Intronic
971284457 4:25274295-25274317 GTGACAGCTGTGGTCCAGGCAGG - Intronic
972564245 4:40255983-40256005 GTAAGAGATGAGGTCCAGGAGGG + Intergenic
972781978 4:42294141-42294163 GTGAAGGCTGGAGTCCAGGCTGG + Intergenic
974295056 4:59987376-59987398 GCAAGATCTGCTGTCCAGGCTGG + Intergenic
982068625 4:151675665-151675687 CTGGGAGCTGCGCTCCTGGCTGG - Intronic
983693589 4:170501936-170501958 GAGAGAGCAGCAGACCAGGCAGG - Intergenic
985270606 4:188191390-188191412 GTCAAAGCTGCTGTCTAGGCCGG + Intergenic
985657536 5:1139961-1139983 GTCACAGATGCGGACCAGGCCGG + Intergenic
988604609 5:32668700-32668722 GAGTGAGCTGCAGTCAAGGCAGG - Intergenic
988845123 5:35119874-35119896 GTGAGGGCTTCGGGGCAGGCGGG + Intronic
990042273 5:51389366-51389388 GCGAGTGCTGCGTTTCAGGCCGG + Intronic
990910122 5:60844137-60844159 GTGAGTGCGGGGTTCCAGGCCGG - Intronic
992320879 5:75611969-75611991 GGGAGTGCAGCGGTGCAGGCTGG - Intronic
996768854 5:127064305-127064327 GTTAGAGCTGCACTCCAGGTTGG - Intronic
996978896 5:129465664-129465686 GTGAAAGCTGCTGTCAGGGCAGG + Intronic
997771421 5:136557613-136557635 CTGAGAGCAGCTGTCCAGGCAGG + Intergenic
998419371 5:141969413-141969435 GTGTGAGCTGCTGGCCAGCCTGG - Intronic
999896698 5:156041995-156042017 GTGAGAGCTAGTGACCAGGCTGG + Intronic
1001064850 5:168528484-168528506 GGAAGAGCTGTGGTCCAGGATGG + Intergenic
1001305584 5:170570096-170570118 GGGAGAGCTGAAGTCCACGCTGG - Intronic
1001586018 5:172834373-172834395 GGGAGCGCTGCAGGCCAGGCGGG - Exonic
1002103631 5:176869366-176869388 GTGTGAGCCGCGGTTCAGCCTGG + Intronic
1002134338 5:177098622-177098644 GGGACAGCTGCAGCCCAGGCGGG - Intergenic
1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG + Intronic
1005502021 6:26436977-26436999 GTAAAAGCTGAGGTCCAGGGAGG - Intergenic
1005961132 6:30694091-30694113 TTTTGAGTTGCGGTCCAGGCTGG + Intergenic
1006131950 6:31874892-31874914 GTGAGATCTGGGGTAGAGGCAGG + Intronic
1006483336 6:34316789-34316811 GTGAGAGCTGAGGTCCCAGAGGG + Intronic
1006718399 6:36134715-36134737 CTGAAAGGTGGGGTCCAGGCCGG + Intronic
1013480705 6:110550475-110550497 CTGGCAGCTGCAGTCCAGGCTGG - Intergenic
1014743138 6:125169348-125169370 TTGAGAAGTGAGGTCCAGGCAGG - Intronic
1017008127 6:150042970-150042992 GAGAGAGCTGGTTTCCAGGCAGG + Intergenic
1019514111 7:1432303-1432325 GTGCCAGGTGCGCTCCAGGCTGG - Intronic
1019888176 7:3923770-3923792 TTGAGGGCTGAGGTACAGGCTGG - Intronic
1021731261 7:23597629-23597651 GCGAGAGGTGCGGGCCCGGCTGG - Intronic
1023896138 7:44434449-44434471 GTGAGAGCTGGGCAGCAGGCAGG - Intronic
1026769788 7:73188327-73188349 GGGAGAGCTGGGCTCCAGACAGG - Intergenic
1026889942 7:73975977-73975999 CTGAGAACTGCAGCCCAGGCTGG + Intergenic
1027010656 7:74741709-74741731 GGGAGAGCTGGGCTCCAGACAGG - Intronic
1027077386 7:75204331-75204353 GGGAGAGCTGGGCTCCAGACAGG + Intergenic
1028612930 7:92732385-92732407 TTGAGAGCTGTCGCCCAGGCTGG - Intronic
1029293815 7:99523243-99523265 GTGAGATCTGGGGTACAGGAAGG + Intronic
1029362982 7:100100696-100100718 GAGAGAGCTGCGGCCCGGGGGGG - Intronic
1029457488 7:100678615-100678637 GTGACAGCTGGGGCCCAGGCTGG + Intronic
1029746479 7:102517943-102517965 ATGAGAGCTGCGGCCCCGGCCGG - Intergenic
1029764416 7:102616922-102616944 ATGAGAGCTGCGGCCCCGGCCGG - Intronic
1032693911 7:134316855-134316877 GTGAGAGCGGCTTTCCAGGACGG - Exonic
1033036727 7:137882491-137882513 GTCAGGGCTGGAGTCCAGGCCGG - Exonic
1033608159 7:142942461-142942483 CTGGGGGCTGAGGTCCAGGCTGG + Exonic
1034826911 7:154273959-154273981 GTGGCAGGTGCAGTCCAGGCAGG - Intronic
1035328755 7:158082980-158083002 AGGAGAGCTGCAGTCCAGGGAGG - Intronic
1035774694 8:2179140-2179162 GGCAGAGCTGGGGTTCAGGCGGG + Intergenic
1036633126 8:10529429-10529451 GTGTGAGCTGGGGACCGGGCTGG - Intronic
1036641995 8:10590516-10590538 GGGAGACCTGAGGGCCAGGCTGG - Intergenic
1038157519 8:25004139-25004161 CAGAGAGCTGAGGTCCAAGCAGG + Intergenic
1038442223 8:27579346-27579368 CTGAGAGGTGAGGGCCAGGCAGG - Intergenic
1038542702 8:28402469-28402491 GGGAGAGCGGCGCCCCAGGCGGG - Intronic
1039893277 8:41698667-41698689 ATGAGAAATGTGGTCCAGGCAGG + Intronic
1039906804 8:41792282-41792304 GAGAGGGCTGCAGTCCAGGCTGG + Intronic
1041698955 8:60766528-60766550 GTGACTGCTGTAGTCCAGGCAGG + Intronic
1047587995 8:126294933-126294955 GTGATAGCTACAGTCAAGGCTGG - Intergenic
1048447783 8:134504894-134504916 GTGGGAGCAGGGCTCCAGGCAGG - Intronic
1049213455 8:141397145-141397167 GTGAGAGCTGTGTTACACGCAGG + Intronic
1049432385 8:142571362-142571384 GTGTGAGGTGGGGTGCAGGCAGG + Intergenic
1049713636 8:144078935-144078957 GTGGGAGCTGCGGGGCAGCCGGG + Intronic
1053221879 9:36319255-36319277 GACAGAGCTGGGGTGCAGGCCGG + Intergenic
1053222572 9:36324553-36324575 TTGAGAGCTGAGGTCCAGGTAGG + Intergenic
1053418179 9:37959781-37959803 GGGAGAGGTGAGGTCCAGGAAGG - Intronic
1055204253 9:73708450-73708472 GTGAGAGTTGTGGGCCAGGAAGG + Intergenic
1056045869 9:82715239-82715261 GAGAAAACTGAGGTCCAGGCAGG + Intergenic
1056630618 9:88290262-88290284 CTGAGACCTGCAGCCCAGGCTGG + Intergenic
1057132651 9:92664805-92664827 CTGAGAGCTGCGATCCAGGAGGG - Intronic
1057259560 9:93576347-93576369 GCGGGAGCGGCGGCCCAGGCCGG + Intergenic
1057876035 9:98755330-98755352 GTGAGACCTGGGGTCCAGGCAGG - Intronic
1059014609 9:110502312-110502334 GTCAGAGCTGCAGACCAGCCTGG - Intronic
1060659735 9:125397790-125397812 GCCAGAGCTGCGCTCCTGGCCGG - Intergenic
1060934133 9:127506030-127506052 GGGAGACCTGTGGGCCAGGCGGG + Exonic
1060964610 9:127705688-127705710 GTGGGAGCAGCTGTTCAGGCGGG + Intronic
1061091333 9:128428262-128428284 GTGAGAGCTGCAGTGGAGGGTGG - Intronic
1061515523 9:131087795-131087817 GTCAGAGCTGCTTGCCAGGCTGG + Exonic
1061599089 9:131654644-131654666 GTGAGCACTGCGCTCCAGCCTGG + Intronic
1061995741 9:134181838-134181860 GTGAGAGCTGCGGCCAGGGGTGG + Intergenic
1062027948 9:134349224-134349246 GTGGGAGCTCGGGGCCAGGCTGG - Intronic
1062277445 9:135737547-135737569 GAGAGAGGTGCAGGCCAGGCCGG + Intronic
1062389790 9:136329401-136329423 GTGGAAGCTGCGGGCCAGACGGG + Intronic
1062559881 9:137136776-137136798 CTGACAGCTGCGGCCCCGGCGGG - Intergenic
1062623908 9:137434496-137434518 GGGAGAGCGGGGGTCCAGGTGGG + Exonic
1185776233 X:2804987-2805009 TGGAGAGCAGGGGTCCAGGCAGG - Intronic
1186436800 X:9550072-9550094 ATGAGAGCAGTGCTCCAGGCGGG - Intronic
1187429208 X:19206309-19206331 GTGGGGTCTGCCGTCCAGGCAGG - Intergenic
1191843028 X:65526549-65526571 GTGAGAACTGCAGTGTAGGCTGG - Intronic
1195210908 X:102651771-102651793 GTGACTGGTGCGGGCCAGGCCGG + Intronic
1195418596 X:104647553-104647575 GAGAGAGCTGCTCTCCAGGCAGG - Intronic
1196113880 X:111976391-111976413 GTGAGAGTGGCACTCCAGGCTGG - Intronic
1197746818 X:129937042-129937064 TTGAGAGCTGCAGTTCAGGTGGG - Intergenic
1201293771 Y:12446722-12446744 TGGAGAGCAGGGGTCCAGGCAGG + Intergenic