ID: 1148496822

View in Genome Browser
Species Human (GRCh38)
Location 17:48058040-48058062
Sequence TTGGCCAGACTCCCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148496822_1148496826 11 Left 1148496822 17:48058040-48058062 CCAAGATGGGGGAGTCTGGCCAA 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1148496826 17:48058074-48058096 AGCTGATCAGTCCTATATTAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1148496822_1148496827 14 Left 1148496822 17:48058040-48058062 CCAAGATGGGGGAGTCTGGCCAA 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1148496827 17:48058077-48058099 TGATCAGTCCTATATTAGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 71
1148496822_1148496825 10 Left 1148496822 17:48058040-48058062 CCAAGATGGGGGAGTCTGGCCAA 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1148496825 17:48058073-48058095 AAGCTGATCAGTCCTATATTAGG 0: 1
1: 0
2: 0
3: 6
4: 94
1148496822_1148496829 25 Left 1148496822 17:48058040-48058062 CCAAGATGGGGGAGTCTGGCCAA 0: 1
1: 0
2: 0
3: 17
4: 154
Right 1148496829 17:48058088-48058110 ATATTAGGGTGGAGCCTACATGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148496822 Original CRISPR TTGGCCAGACTCCCCCATCT TGG (reversed) Intronic
900396640 1:2455757-2455779 GTGGCCATACTCCCCGAACTGGG - Intronic
901678840 1:10901717-10901739 TGGGCCAGACCCCACCACCTCGG - Intergenic
901686958 1:10948386-10948408 TTGGCCGGGCTCCCCCATGATGG + Exonic
902053510 1:13582369-13582391 TTGAACTGACTTCCCCATCTTGG - Intergenic
904541679 1:31238113-31238135 TTGTCCAGTCTCCCACAGCTGGG + Intronic
905627992 1:39501124-39501146 TTTAACAGCCTCCCCCATCTAGG + Intronic
905880425 1:41459782-41459804 ATGGGCAGAAGCCCCCATCTGGG - Intergenic
906356096 1:45106671-45106693 TCCGCCAGGCTGCCCCATCTGGG + Intronic
906461788 1:46040180-46040202 TTGGCCAGACTGTCCCCTCTTGG + Exonic
907410098 1:54277858-54277880 TTGGCCAGCCTCACTGATCTGGG - Intronic
912704816 1:111904159-111904181 TTGGCGGGACTCCACCATCTGGG - Intronic
919800925 1:201354211-201354233 TTGGCCAGCCTCCTCCTTCTTGG - Intergenic
919934862 1:202244900-202244922 TTGGCCAGATGCCCCCATGGTGG - Intronic
920277882 1:204821230-204821252 TGGGCCAGACCCACCCAGCTGGG - Intergenic
923233153 1:232007527-232007549 TTGGCCAGTTTCTCCCATTTGGG + Intronic
1063974026 10:11401311-11401333 CTGGCCTGACTGCCACATCTGGG - Intergenic
1067160173 10:43819104-43819126 TGGGCGAGCCTCCTCCATCTGGG + Intergenic
1068165218 10:53322244-53322266 TTGGCCTGATTTCCTCATCTAGG - Intergenic
1070551573 10:77494574-77494596 TTGGCAAGGCCTCCCCATCTGGG - Intronic
1074768054 10:116715022-116715044 TTGTCGAGTTTCCCCCATCTGGG - Intronic
1075395837 10:122126410-122126432 TTGACGCGACTCCCCCAGCTGGG + Intronic
1076000364 10:126908107-126908129 TTAACCAGAGTCCCCCATCAGGG + Intronic
1076439589 10:130471961-130471983 TCTGCCAGCCACCCCCATCTGGG + Intergenic
1076667272 10:132100356-132100378 TGGCCCAGACACCCCCACCTTGG - Intergenic
1080633628 11:34104575-34104597 TTGCCAGGACTCCCCCATCTTGG + Intergenic
1084700954 11:70785783-70785805 TTGGGCATCATCCCCCATCTCGG + Intronic
1085523602 11:77151971-77151993 TTGGCAAGTCTCCCACTTCTTGG + Intronic
1087238570 11:95749867-95749889 TTTTCCAGATTCTCCCATCTAGG + Intergenic
1090716133 11:129433151-129433173 TTGCCCAGTCTTTCCCATCTTGG + Intronic
1092114630 12:5990808-5990830 TTTACCAGACTCCTCCGTCTTGG - Intronic
1092229385 12:6768208-6768230 CTGGCCTGACTTTCCCATCTGGG - Intronic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1094775765 12:33725503-33725525 TTGGCTAGATTCACCCATCCTGG - Intergenic
1095493369 12:42759455-42759477 ATGGCCAGTCTCCTCCAACTTGG + Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1100465435 12:94840330-94840352 TTGCCCAGACACCCCCAGTTTGG + Intergenic
1103731819 12:123032924-123032946 TTGTCCAGGCTCCCCTATGTGGG - Intronic
1104265356 12:127227174-127227196 TTGGCAAGCCTCCCCCATTCAGG - Intergenic
1104978326 12:132561905-132561927 TGGGCCAGGCTCCCAAATCTGGG - Intronic
1111074732 13:83218543-83218565 TTGGCCAGAGTCCCCTTTTTGGG - Intergenic
1113345997 13:109479201-109479223 TAAGCCAGACACCCCCATCTTGG + Intergenic
1118392163 14:65304546-65304568 TTGGCCAGCCTCCCACATGCAGG + Intergenic
1120799697 14:88674852-88674874 TTGGCCAGTTTCCCCTATTTGGG - Intronic
1121455395 14:94035647-94035669 TTGCCCTGAATCCCCCATGTCGG + Intronic
1122135920 14:99632996-99633018 TTGGCCAGACTCGCCCAGATGGG - Intergenic
1122580569 14:102769134-102769156 TTGTCCAGAATCACCCCTCTTGG + Intergenic
1124150999 15:27178065-27178087 TTGACAAGAATCCTCCATCTGGG - Intronic
1124841146 15:33243259-33243281 TTGGCCAGAGTTCACCATGTTGG - Intergenic
1127835077 15:62784079-62784101 TTGGCCAGTCTGCCCCATAAGGG - Intronic
1129343591 15:74902455-74902477 CAGGCCAGAGGCCCCCATCTGGG - Exonic
1129851665 15:78797204-78797226 TTGGCCAGCCTCCCCAGGCTGGG - Intronic
1130251325 15:82301886-82301908 TTGGCCAGCCTCCCCAGGCTGGG + Intergenic
1130833033 15:87621137-87621159 TAGGCCAAACTCCCCCATGAGGG - Intergenic
1132641007 16:978600-978622 TGGTCCAGATTCCCCCATCAGGG + Intronic
1140755553 16:78063346-78063368 TTTGCCAGAATCCCCCATCCTGG - Intronic
1140924164 16:79566707-79566729 TTGGCCTGAATCCTTCATCTTGG + Intergenic
1141273141 16:82558784-82558806 TTGGCCAGTTTCTCCCATTTGGG + Intergenic
1142289197 16:89185033-89185055 ATGGACTGACTGCCCCATCTGGG + Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1150417586 17:64999882-64999904 TTGGCCAGACTGGACCATGTTGG - Intergenic
1151331392 17:73411302-73411324 TTGTCCAGCCTCCCCCACTTTGG + Intronic
1153814772 18:8782985-8783007 GTGGCCTGACTTCCCCATCCTGG + Intronic
1154192665 18:12243475-12243497 TCTGCCAGACTGCCCCATCTAGG + Intergenic
1154420363 18:14223383-14223405 TCTGCCCGACTGCCCCATCTGGG + Intergenic
1161566858 19:5007209-5007231 TTGGCCAGGCTCTGCCATATTGG + Intronic
1163708665 19:18832528-18832550 TTGGCCGGAGTCCCCCATCGCGG + Intronic
1165303380 19:34987550-34987572 TTGGCCAGCCTTCACCATGTTGG + Intergenic
1166121066 19:40687075-40687097 TCGGCCAGCCCCCTCCATCTTGG + Intronic
1167483572 19:49747192-49747214 AGGGCAAGAGTCCCCCATCTGGG + Intronic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
927516052 2:23672245-23672267 TGGCCCAGATCCCCCCATCTTGG + Intronic
927888000 2:26730331-26730353 TGGTCCAAACTCCCCCACCTGGG - Exonic
928102813 2:28449346-28449368 CTGGCCACATTCCCCCTTCTTGG - Intergenic
928634723 2:33232218-33232240 TTAGCCAGAATCCCCCATGCTGG - Intronic
931824884 2:65990323-65990345 TTAGCCAGAATACCCCATCCTGG + Intergenic
934517475 2:94997939-94997961 TTGGCATGACCCCACCATCTTGG - Intergenic
935218209 2:100990927-100990949 CTGGCCAGACTCACCCGCCTGGG + Intronic
936549870 2:113427789-113427811 TTGGCCAGTTTCTCCCATTTGGG + Intergenic
937228752 2:120384692-120384714 CAGGCCAGACTCCCCCATCCAGG - Intergenic
943202390 2:184845503-184845525 TTGCCCACACTTCCCCAACTTGG + Intronic
945257858 2:207817276-207817298 TTGTCCAGACTCTCCCAACATGG - Intergenic
948742338 2:240056230-240056252 TGGGCCAGACTTCGCCGTCTTGG - Intergenic
1170070156 20:12357877-12357899 GTGGCCTAACTCTCCCATCTAGG - Intergenic
1173664454 20:44754647-44754669 TGAGCCAGGCTGCCCCATCTAGG + Intronic
1174809509 20:53633624-53633646 GTGGCCTGACTCTACCATCTTGG + Intergenic
1175183679 20:57165811-57165833 CAGGCCAGAGTCCCCCATCCAGG - Intergenic
1176797503 21:13380655-13380677 TCTGCCAGGCTGCCCCATCTGGG + Intergenic
1178488438 21:33033175-33033197 TGTCCCCGACTCCCCCATCTGGG + Intergenic
1181005611 22:20012092-20012114 TTGGTCACACTTCCCCAACTGGG - Intronic
1181311365 22:21946596-21946618 TGGGCCGGCCTCCCGCATCTTGG - Intronic
1181475621 22:23166254-23166276 TTGGCCAAAATGCCCCATTTTGG - Intergenic
1181568289 22:23752567-23752589 TGGCCCAGACTCCCCCACCATGG - Intergenic
1181743875 22:24942436-24942458 TTGGGCAGGCTCACCCTTCTGGG - Intronic
1184255971 22:43287181-43287203 CTGGCCAGATTCCAACATCTCGG + Intronic
1185002472 22:48254274-48254296 CTGGCCAGCCTCCCCCAAATAGG - Intergenic
955949401 3:64226956-64226978 TTGCCCACACTCCCCCGCCTGGG + Intronic
958405956 3:93760192-93760214 TCTGCCAGGCTGCCCCATCTGGG - Intergenic
961369886 3:126422770-126422792 CTGCCCTGCCTCCCCCATCTAGG - Intronic
962412926 3:135157139-135157161 TTGTCCAGAGTCCCACAGCTGGG + Intronic
968601999 4:1513828-1513850 GTGGCCATACTCTTCCATCTTGG + Intergenic
968942593 4:3646521-3646543 GTGGCCAGACTCAGCTATCTGGG + Intergenic
969683410 4:8655896-8655918 TTGCCCAGAATGCCCCTTCTGGG + Intergenic
970483174 4:16498324-16498346 TAGGCTTGACTGCCCCATCTGGG - Intergenic
972374364 4:38456812-38456834 TTGGCCAGGATCCTCAATCTTGG + Intergenic
976360089 4:84167648-84167670 TTGGCAAGACTCCCCAGTGTGGG - Intergenic
983462994 4:168049467-168049489 TTGGCCAAATTCTCCCATTTGGG + Intergenic
983571005 4:169208027-169208049 TTTGCCAGGCTTCCACATCTGGG + Intronic
984520003 4:180790083-180790105 TGAGCCAGACTCTACCATCTGGG + Intergenic
984879842 4:184401061-184401083 TTGTCCAGACTCGCACAGCTTGG + Intronic
985692444 5:1320953-1320975 TTGCCCAGGCTCCCACATCGGGG + Intronic
986678998 5:10216305-10216327 TTGGGCAGAACCCCCCTTCTCGG - Intergenic
988213485 5:28240799-28240821 TTGACCAGACTCCCTTATATAGG + Intergenic
989693327 5:44170909-44170931 TTGGCTAGAACCCTCCATCTTGG + Intergenic
991094084 5:62720860-62720882 TTGCCCAGCCTAACCCATCTAGG - Intergenic
996753486 5:126912804-126912826 ACGGCCAGCCTCCCCCAGCTTGG + Intronic
1002192465 5:177485438-177485460 CTGGCCAGACCCACACATCTTGG - Intronic
1005430686 6:25753693-25753715 TGGCCCAGGATCCCCCATCTTGG - Intergenic
1006809630 6:36811476-36811498 TTGGCCAAGATCCCCCACCTGGG + Intronic
1007269414 6:40624748-40624770 TTGCCCCTACTTCCCCATCTGGG - Intergenic
1008334262 6:50281426-50281448 CTGGCCAGACACCCACATCCTGG + Intergenic
1009844741 6:69121654-69121676 TCGGCCTGGCTGCCCCATCTGGG - Intronic
1009868881 6:69432326-69432348 TCTGCCAGGCTGCCCCATCTGGG - Intergenic
1018489785 6:164280037-164280059 TTGGCCAACCTCTCCCATTTGGG + Intergenic
1019867455 7:3725626-3725648 TTGGCCAGCCTCCCTGTTCTTGG - Intronic
1023639267 7:42241335-42241357 TTGGCCAGGCTCACCTCTCTAGG + Intergenic
1024308887 7:47950933-47950955 TGGGCCATACTCCTCCACCTGGG + Intronic
1026824832 7:73575020-73575042 TTGGCCAGACATCCCTATGTAGG + Intronic
1031488169 7:122354863-122354885 TTGGCTAGACAACCCTATCTTGG - Intronic
1033480682 7:141737474-141737496 GTGTCCAGGCTCCACCATCTAGG + Intergenic
1037899948 8:22682241-22682263 TTGTCCAAACTCACACATCTAGG - Intergenic
1040620433 8:49085992-49086014 AGTGCAAGACTCCCCCATCTTGG + Intergenic
1041724557 8:61005890-61005912 TTGGTCCGACTCCCCCGCCTCGG - Intergenic
1045965071 8:108015564-108015586 TTAGCCAGAATCCCCCATCCTGG + Intronic
1049285235 8:141771330-141771352 TTTGCCTGACTCCTTCATCTCGG + Intergenic
1059037738 9:110775942-110775964 TGTGCCAGACTGCCACATCTAGG + Exonic
1060228801 9:121812407-121812429 TTGGCCAGAGCCCCCTCTCTAGG + Intergenic
1061482466 9:130903733-130903755 TGGGGCAGACTCCACCATCCTGG + Exonic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186000433 X:5003091-5003113 TAGGTCAGCCTCCCCCACCTGGG - Intergenic
1189487507 X:41444697-41444719 TTGGCCAGGCTTCCCCACCTTGG - Intergenic
1195554778 X:106209965-106209987 TTGGCCAAATTCTCCCATTTGGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1196704910 X:118708644-118708666 TTTCCCAGAATTCCCCATCTCGG + Intergenic
1197136462 X:123066100-123066122 TTGGTAAGTCTCCCCTATCTGGG + Intergenic
1197152650 X:123236984-123237006 TTGGCCTGAAGCCCCCATTTTGG - Intronic
1197570901 X:128149219-128149241 TTGGCCTGTCTCGCCCAGCTGGG - Intergenic
1199673831 X:150167762-150167784 TAGGCTAGTCACCCCCATCTAGG - Intergenic
1200848627 Y:7859223-7859245 TGTGCCAGACTGCCCCATGTGGG + Intergenic