ID: 1148498984

View in Genome Browser
Species Human (GRCh38)
Location 17:48074662-48074684
Sequence TTTATTAAGGAGGTGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148498975_1148498984 21 Left 1148498975 17:48074618-48074640 CCTGAGAATTTAGCAGAATTTCT 0: 1
1: 0
2: 2
3: 21
4: 289
Right 1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 247
1148498973_1148498984 27 Left 1148498973 17:48074612-48074634 CCTAACCCTGAGAATTTAGCAGA 0: 1
1: 0
2: 1
3: 6
4: 154
Right 1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 247
1148498974_1148498984 22 Left 1148498974 17:48074617-48074639 CCCTGAGAATTTAGCAGAATTTC 0: 1
1: 0
2: 2
3: 22
4: 271
Right 1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148498984 Original CRISPR TTTATTAAGGAGGTGGTAGA AGG Intronic
900488965 1:2936868-2936890 TTTGTGTAGGAGGTGGGAGAGGG + Intergenic
901145071 1:7059262-7059284 TTTGTCAAGGAGGTGGTGGGTGG + Intronic
901154510 1:7126336-7126358 TGAATTAGGGAGGGGGTAGAAGG - Intronic
901229099 1:7632042-7632064 TTTATTAGGGACGGGATAGAGGG - Intronic
901781955 1:11599994-11600016 TTTAATGAGGAGATGGCAGAGGG + Intergenic
902960117 1:19957371-19957393 TTCTTTAAGGAGGTAGTGGAGGG + Intergenic
904893177 1:33794534-33794556 TTAAGCAAGGAGGTGGTGGAGGG + Intronic
904973345 1:34435944-34435966 TTTATTAAGGATCTGGTTGAAGG + Intergenic
905126077 1:35717119-35717141 GTTATTAATGAGATGGGAGAAGG - Intronic
905609170 1:39334080-39334102 TTGACTAAGCAAGTGGTAGATGG + Intronic
905785559 1:40754298-40754320 TCTAGTAAGGAGGTGACAGAGGG - Intronic
907727621 1:57034457-57034479 TTTCTCAAGCAGCTGGTAGAGGG + Intronic
909508539 1:76423430-76423452 TTTATGAAGAAGGTGGTATGAGG + Intronic
910405951 1:86890464-86890486 GTTATTAAGTAGAGGGTAGAAGG - Intronic
912146509 1:106800448-106800470 CTTATTAAGGACTGGGTAGATGG - Intergenic
914468547 1:147951482-147951504 TCTATTAAGGAGGAAATAGATGG + Intronic
914685139 1:149971921-149971943 TGAATTAAGGTGGTAGTAGATGG - Intronic
916177026 1:162050609-162050631 TTTTTAAAACAGGTGGTAGAAGG - Intergenic
916934597 1:169614526-169614548 TTTATTAATGAGGTCATAGTTGG + Intronic
919186976 1:194163603-194163625 TAAATTAAAGAAGTGGTAGATGG + Intergenic
919939763 1:202278224-202278246 TAGTTTAAGGAGGTGGCAGAAGG + Intronic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
921873357 1:220166491-220166513 TTTAAAAAGGAGGTGGAAGGAGG + Intronic
922677946 1:227564160-227564182 TTTATGGAGGAGGTGCTTGAAGG + Intronic
1063902553 10:10749313-10749335 TTTATTATAGAGGGAGTAGAAGG - Intergenic
1063964443 10:11335703-11335725 TTTATTAGGGAGGTGGGAGGGGG + Exonic
1065108642 10:22417548-22417570 TTTACTTAGGAAGTGGTAAACGG + Exonic
1066541440 10:36451104-36451126 TTTATTTAGGAGGGTTTAGAGGG - Intergenic
1068513715 10:57999371-57999393 TCTTTCAAGGAAGTGGTAGAGGG - Intergenic
1068746980 10:60543779-60543801 GTAATTAAGTAGGTGGGAGAAGG - Intronic
1068756853 10:60665136-60665158 TTTATTGATGAGGAGGCAGAGGG - Intronic
1072899189 10:99392523-99392545 TGTAGTAAGGGGGTGGGAGAAGG - Exonic
1074953488 10:118364111-118364133 TTGATAAAGGAGGTGGTTGAGGG + Intergenic
1075185599 10:120253719-120253741 TTTATTCAGAAGGTTCTAGAGGG - Intergenic
1077233062 11:1467130-1467152 GTTGTTAAACAGGTGGTAGAAGG - Intergenic
1078160776 11:8837908-8837930 TTTATGAAGGAGGTGGAAGGTGG + Intronic
1083303139 11:61749135-61749157 TTCATTATGGAGTTGGCAGATGG + Intergenic
1083590109 11:63888777-63888799 TTCACTGAGGAGGTGGTGGAAGG + Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084704947 11:70810696-70810718 TTTGTAAAATAGGTGGTAGAGGG + Intronic
1085365855 11:75943705-75943727 TCTATTGAGGAGATGGTAGGTGG - Intronic
1085865190 11:80282431-80282453 TATGTTAATGAGGTGGGAGATGG - Intergenic
1086111813 11:83207455-83207477 GTAATTTAGGAGGAGGTAGAGGG + Intronic
1091158463 11:133396802-133396824 TTTATAAAGGAGGTGATATTGGG - Intronic
1091988236 12:4931703-4931725 TTTATTAATGATGAGGTAGGAGG - Intergenic
1092123312 12:6059195-6059217 TTAAATAAGGAGGTGGGAGAAGG - Intronic
1092962882 12:13612901-13612923 TTTATTAATGATTTGGAAGATGG - Intronic
1094233996 12:28142352-28142374 TTTTTGAAGGAGGGGATAGACGG - Intronic
1096362337 12:50998851-50998873 TTAATTAAGGAGGGGGTTGCAGG - Intronic
1096755319 12:53794489-53794511 ATCCTTAAGGAGGTGGTAGGGGG + Intergenic
1097098533 12:56569649-56569671 TTTCTTAAGGGGGAGGGAGAAGG + Intronic
1098105372 12:67064629-67064651 TTTGTTAAGGAGGTTGTGGGTGG + Intergenic
1098998850 12:77152982-77153004 TATGTGAAGGAGCTGGTAGAAGG - Intergenic
1099349820 12:81551791-81551813 GTAATTAAGGAGGTCGTAAAAGG - Intronic
1099584696 12:84502561-84502583 TTTATTGAGGATGTGTTTGAGGG + Intergenic
1100387209 12:94114649-94114671 TTTATAAAGTAAGTGGTACAAGG - Intergenic
1101859802 12:108473885-108473907 TGTATTCAGGAGATGGGAGAGGG - Intergenic
1103311072 12:120008752-120008774 TATATTAAGGATGTACTAGAAGG + Intronic
1105600324 13:21880979-21881001 TTTATGAAGAAGCTGGCAGAAGG + Intergenic
1106394462 13:29366955-29366977 TGTATTAAGGAGGAGGCAGAGGG - Intronic
1107480080 13:40779102-40779124 TTTCTTTAGAAGATGGTAGAGGG - Intergenic
1107882921 13:44848968-44848990 TTCATTAAGGTTGTCGTAGATGG + Intergenic
1109805077 13:67429195-67429217 TTTATTCAGGTGGTTGCAGAGGG - Intergenic
1109877737 13:68428116-68428138 TTTATTAATGAGGAAGAAGAAGG + Intergenic
1111283393 13:86056495-86056517 TCTATTAGGGAGTGGGTAGATGG - Intergenic
1112797814 13:103076379-103076401 ATTACTCAGGAAGTGGTAGACGG + Intergenic
1112965398 13:105185476-105185498 TTTATTCAGGAGGTGCTCGAAGG - Intergenic
1113307949 13:109098431-109098453 GTGCTTAAAGAGGTGGTAGATGG + Intronic
1114504783 14:23201952-23201974 TTTATTAAGGAGTTGGAGGCCGG + Intronic
1116360742 14:43993884-43993906 TTTATTAAGAAAGTAATAGAAGG + Intergenic
1116919198 14:50555031-50555053 TTTATCAATGAGGTGGGACATGG + Intronic
1117031549 14:51676451-51676473 TTTTTTAAGTATGTGGTACATGG + Intronic
1118350017 14:64967035-64967057 TTGACTGAGGAGGTGGGAGATGG - Intronic
1119460898 14:74802616-74802638 TTGATTCCTGAGGTGGTAGATGG - Exonic
1119464667 14:74846455-74846477 TTTGTGGAGGAGGTTGTAGATGG + Intronic
1121870255 14:97400766-97400788 ATTGTTGAGGAGGTGGAAGAAGG - Intergenic
1121935727 14:98016880-98016902 TTTATTGAGGGGGTGGTGGTGGG - Intergenic
1123538846 15:21266392-21266414 TTTATTCAGGAATTGGTTGAGGG + Intergenic
1126958876 15:53967684-53967706 GTGATTAAGGTGGTGGCAGAAGG + Intergenic
1127453219 15:59136382-59136404 TTTATTTAGGAGGTGGGGGCAGG + Exonic
1127714193 15:61632414-61632436 TATAGTAAGGAGGAGGCAGAGGG - Intergenic
1129417880 15:75398329-75398351 TGAATAAATGAGGTGGTAGAAGG - Intronic
1130843853 15:87726045-87726067 TTGATTAGGGAGATGGTGGAGGG + Intergenic
1130846919 15:87756226-87756248 GTTATTAAGGAGTTGGAAGAAGG - Intergenic
1133528684 16:6632058-6632080 TTTAGTAAGGATGTGCTGGAAGG + Intronic
1134256194 16:12613606-12613628 TTTAACAAAGAGGTGGTGGAAGG - Intergenic
1135695398 16:24582055-24582077 TTTATTGAGAGGGTGGGAGAGGG - Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137663483 16:50231554-50231576 TATATTAAGGTGGTGGTAGCGGG + Exonic
1140103713 16:71940196-71940218 TTTAGTCATGGGGTGGTAGAAGG - Intronic
1141171622 16:81695263-81695285 TTTAGGAAGGAGAAGGTAGAAGG - Intronic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1144298228 17:13899511-13899533 TCTATAAAGGAGGTGGTTGGTGG - Intergenic
1144348144 17:14368441-14368463 TTTAGGAGGGAGGTGGCAGAGGG - Intergenic
1144653484 17:17021202-17021224 TTTAGTGAGGAGGTGGGTGAGGG + Intergenic
1146220691 17:31016909-31016931 TTTGCTAAGGTGGTGGTTGATGG + Intergenic
1148154516 17:45415204-45415226 ATCATCAAGGAAGTGGTAGAAGG - Intronic
1148387484 17:47244821-47244843 TTTATCAAGGAAGTTGTGGAGGG - Intergenic
1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG + Intronic
1150367088 17:64598454-64598476 TTTGCTAAGGTGGTGGTTGATGG - Exonic
1153535656 18:6098886-6098908 TTTATGAAGGAGTAGGTAGGAGG + Intronic
1156744833 18:40377272-40377294 TTTATTAATGAGCTGAAAGAGGG - Intergenic
1156919545 18:42504191-42504213 TTGTTGCAGGAGGTGGTAGAGGG + Intergenic
1159527103 18:69606474-69606496 TTTCTTAAAGATGTGGTACAAGG + Intronic
1161757564 19:6145510-6145532 TCTACTGGGGAGGTGGTAGATGG - Intronic
1162240616 19:9350589-9350611 TTACTTTTGGAGGTGGTAGAAGG + Intronic
1166450386 19:42894310-42894332 TTTTTTAAGGAGGCTGCAGATGG + Intronic
1166462275 19:42998618-42998640 TTTTTTAAGGAGGCTGCAGATGG + Intronic
1166479549 19:43158581-43158603 TTTTTTAAGGAGGCAGCAGATGG + Intronic
1167815156 19:51873927-51873949 TTTTTTGTGGAGGTGGCAGAAGG + Intronic
1168472041 19:56647830-56647852 TTTATGAAGGAAGTGTTGGAGGG - Intronic
925765250 2:7227704-7227726 TTCATGAAGGAGGAGGGAGAGGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
926939131 2:18116577-18116599 ATTTGAAAGGAGGTGGTAGAGGG - Intronic
928061523 2:28117962-28117984 CGTATTAAGGATGTGGTAAATGG + Intronic
928385112 2:30860573-30860595 TTTATAGAGGCTGTGGTAGATGG - Intergenic
929611482 2:43274041-43274063 TTTAGGAGGGAGGTGGAAGAGGG - Intronic
930718330 2:54614337-54614359 TATATTCAGGAGCTGGTGGAAGG - Intronic
932213727 2:69952842-69952864 TTTGTTATGGAGGTGAGAGAGGG - Intergenic
932339388 2:70951591-70951613 TTTTTAAAGGTGGTGGTTGAAGG - Intronic
933811779 2:86037147-86037169 TTAATTAAGGAGCTGGCAGGCGG + Intronic
939656230 2:144829310-144829332 TTTATTAAGGAAGGGTTATATGG - Intergenic
940569279 2:155409729-155409751 TTTATTAAGGAGTTTGCAGCTGG + Intergenic
940645771 2:156391604-156391626 TTGATAAAGGATATGGTAGAAGG - Intergenic
941396091 2:164975051-164975073 TTTATTCAGGAATTGGTTGAGGG + Intergenic
942150083 2:173067306-173067328 TTTATTAATGATCTGGAAGAAGG + Intergenic
943231083 2:185253111-185253133 TTTATTAAGTATGTGGTAGTGGG - Intergenic
944684293 2:202104683-202104705 TTGATAAAGGAGGTTGTTGAGGG + Intronic
944734985 2:202554543-202554565 TTTATAAGGGAGATGATAGAAGG - Intronic
944777202 2:202978848-202978870 TTTATTAAGAAAGAGGTTGATGG + Intronic
945548478 2:211188558-211188580 TTTATCAAGGAGGAGAAAGAAGG + Intergenic
946853414 2:223929625-223929647 TTTTTAGAGAAGGTGGTAGAGGG - Intronic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
948925990 2:241098377-241098399 TTTTTTGAGGCAGTGGTAGAAGG - Intronic
1169790419 20:9404185-9404207 TTCCTTGAGGAGGTGGAAGAGGG + Intronic
1170033488 20:11966638-11966660 CTGATTCAGGAGGTGGGAGACGG - Intergenic
1170512227 20:17089655-17089677 ATTAGTATGGAGGTGGAAGAGGG - Intergenic
1176129736 20:63491675-63491697 TGTATGAATGGGGTGGTAGATGG + Intronic
1176181983 20:63753884-63753906 TATCTTCAGGAGGTGGCAGAGGG - Intronic
1177046518 21:16177138-16177160 TTTATTGAAGAAGGGGTAGAGGG - Intergenic
1179907045 21:44427810-44427832 TTGAGTAAGGAGGTGGTAGGAGG + Intronic
1181621746 22:24096012-24096034 TTTATGAAGGAGGCTGCAGAAGG + Exonic
1183909613 22:41068612-41068634 TGGATTAAGGAGGTGGTGGTGGG - Intergenic
1183998512 22:41654666-41654688 TTTATTTATCACGTGGTAGAGGG + Intronic
1184526133 22:45024185-45024207 TTTATTAGGGAGTTAGAAGATGG + Intergenic
951096759 3:18641304-18641326 TCTATTAAGGATGAGGGAGATGG - Intergenic
951997633 3:28748766-28748788 TTCTCTAAGGAGCTGGTAGATGG + Intergenic
954422967 3:50428322-50428344 TTTAGAAAGGAGGTGGGAGCTGG + Intronic
955007661 3:54984768-54984790 TTTATTTAGGAGGTAATAGCAGG + Intronic
956066253 3:65400344-65400366 TTTATTAAGGAGATGAGAGAGGG - Intronic
956602873 3:71041385-71041407 ATTATTAAGGAGGTCTTGGAAGG + Exonic
956809987 3:72855543-72855565 TTTATTAAGGAGGAGGTGAAAGG - Intronic
957840208 3:85658537-85658559 TTTATAGAGGAATTGGTAGATGG - Intronic
958490785 3:94769395-94769417 TTTAGTAATGTGGTGGTAAAGGG - Intergenic
959327314 3:104954447-104954469 TCTATTAAGGTGGGGGTAGATGG - Intergenic
960761865 3:121080623-121080645 TTGTTTAAGGAGGTGGAAGATGG + Intronic
961382387 3:126504249-126504271 CTTATAAGGGAGGTGGGAGAAGG - Intronic
962631981 3:137286448-137286470 TTTTTTAAAAAGGTAGTAGAGGG - Intergenic
965621221 3:170644060-170644082 TGCATTAAGCAGGTGGAAGAAGG + Intronic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966653681 3:182329065-182329087 TTTATTGATGAGGTGAGAGATGG - Intergenic
967459326 3:189726978-189727000 TTTATTTAGGTGTTGGTATATGG - Intronic
967704749 3:192636928-192636950 CTGATTAGGGAGGTGGGAGAAGG + Intronic
967739760 3:192992068-192992090 TTGATTAAGTTGGTGGCAGAGGG + Intergenic
972586351 4:40440284-40440306 TTTCTTGAGGAGGTGGGAGGGGG + Intronic
973004835 4:44993704-44993726 TTTATTAAGGATGCGTTTGAGGG - Intergenic
973805620 4:54523424-54523446 TGGATTAGGGTGGTGGTAGAGGG + Intergenic
974447132 4:61999033-61999055 TTTATATAGGAGCTGTTAGATGG + Intronic
975670704 4:76778089-76778111 TTTATTCAAGAGGTGGAAGAGGG + Intronic
975790361 4:77943180-77943202 TTTTTTAAGGAGGCTGAAGATGG + Intronic
976857679 4:89624171-89624193 TTTATTAAGGTCCTGGTAGGAGG - Intergenic
978541162 4:109817424-109817446 ATTGTTAAAGAGGTGGTAGTGGG + Intronic
978895654 4:113884602-113884624 TTAATAAAGGAGGTGGCTGAAGG - Intergenic
979003289 4:115255389-115255411 TTAATCAAGGAGTTGATAGATGG + Intergenic
979024197 4:115547032-115547054 TTTAATAAGGAGTTGGTTAATGG + Intergenic
981580882 4:146247423-146247445 ATTTTTAAGAAGGTGGTAGTGGG + Intergenic
981619972 4:146684588-146684610 TTAAGGAAGGAGGAGGTAGAGGG - Intergenic
982107602 4:152024380-152024402 AGACTTAAGGAGGTGGTAGAGGG - Intergenic
983670094 4:170226812-170226834 TTTAGGAAGAGGGTGGTAGAGGG - Intergenic
984464282 4:180077994-180078016 TTAGGAAAGGAGGTGGTAGAGGG + Intergenic
986157901 5:5195217-5195239 TGTATTAAGCTGGTGGTACAAGG + Intronic
986345104 5:6827345-6827367 TTTATGGAGGAGGAGGGAGATGG + Intergenic
987246570 5:16054962-16054984 GTTATTAAGGTGGTGGCAGTTGG + Intergenic
988131915 5:27117688-27117710 TTCATTCAGGAGGTGGAAGGAGG - Intronic
988458551 5:31411054-31411076 GTTATTAAGGAGAAGGTAAATGG - Intronic
988967704 5:36436930-36436952 GCTATCAAGGAGGTGGAAGAGGG + Intergenic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
992570611 5:78053263-78053285 TGAATTAAGCTGGTGGTAGAGGG - Intronic
994006444 5:94843171-94843193 TCTACTCAGGATGTGGTAGAGGG - Intronic
994313811 5:98308703-98308725 GTTTTTTAGGTGGTGGTAGAGGG - Intergenic
994982545 5:106894574-106894596 TTGATTAGGGAAATGGTAGAAGG - Intergenic
995266518 5:110167915-110167937 TTTAAGAAGGAGGTGATAGTTGG + Intergenic
995589039 5:113679265-113679287 TTTATTTTGGAGGGGGTACAGGG + Intergenic
995952922 5:117738648-117738670 TTAAAGGAGGAGGTGGTAGAAGG + Intergenic
997246481 5:132354259-132354281 TTTATTAAGGAGGTGGCATTTGG - Intergenic
997815344 5:137011634-137011656 TTTATTGCTGATGTGGTAGATGG - Intronic
998439203 5:142142238-142142260 GCTGTTGAGGAGGTGGTAGATGG - Intronic
998912105 5:146970682-146970704 TTTACAAAGGAGATGGTAAAGGG + Intronic
999162755 5:149518247-149518269 TTCAGTAAGGAAGAGGTAGAAGG + Intronic
999514184 5:152284489-152284511 TTTATGAAAGAGGTGGTATTTGG + Intergenic
999657700 5:153826832-153826854 TTTGTTAAGCAGGTGGAAGTTGG + Intergenic
1001537811 5:172510665-172510687 TTTATGAAAGAGGTGGTTAATGG + Intergenic
1003135794 6:3433915-3433937 TTAATTTAGGGGGTGGTTGATGG + Intronic
1003887875 6:10537091-10537113 TTTCTTAGGAAGGTGGTAAATGG + Intronic
1004367065 6:15021641-15021663 TTCATTCTGGAGGTGGGAGAGGG - Intergenic
1007893645 6:45323230-45323252 TTTATAAAGGAGGTTGTTGAAGG - Intronic
1008854192 6:56061746-56061768 TTAATTAAGTATGTGGTAAAAGG - Intronic
1011366968 6:86593303-86593325 TTTATTAAGGTAGTAGGAGAGGG + Intergenic
1012604096 6:101135280-101135302 TTTTTTATGAATGTGGTAGACGG - Intergenic
1013816734 6:114108294-114108316 CTTATTGAGGCGGTGGCAGAGGG - Intronic
1013924642 6:115455714-115455736 TCTATTAAGGAGGCTGCAGATGG + Intergenic
1014147936 6:118019751-118019773 TATATTAAGGAGGGAGAAGAGGG + Intronic
1014909058 6:127067427-127067449 TTTCTTAATGAGGTGGCAGTGGG - Intergenic
1017190429 6:151648083-151648105 GTTATGGGGGAGGTGGTAGAGGG + Intergenic
1018352435 6:162974216-162974238 TTTATTACAGAGGTGGCATATGG - Intronic
1021004016 7:15371023-15371045 CTTATTCAGTAAGTGGTAGAGGG + Intronic
1021827365 7:24568734-24568756 TTTGTTCAGGAGATGGTAAAAGG + Intergenic
1024190069 7:46997106-46997128 TGGATTAATGAGGTTGTAGAAGG - Intergenic
1026517197 7:71083076-71083098 CTCACTAAGGAGGTGGTAGTTGG - Intergenic
1027620905 7:80483775-80483797 TTCATTGAGGAGGTGGTATTGGG - Intronic
1027657984 7:80955120-80955142 ATTATTCAAGAGGTGGTAGGAGG - Intergenic
1028217259 7:88149295-88149317 TGTATTAAGTAGGTAGTACAAGG + Intronic
1028391280 7:90320699-90320721 TTTTTTAGGGAGGTGGCAGACGG - Intergenic
1028795450 7:94896661-94896683 CTCATAAAGGAGGTGGTAGTGGG - Intergenic
1028944977 7:96569170-96569192 GATATTAAGGTGGTGGTAGTGGG + Intronic
1029246042 7:99202381-99202403 TTTAATAAGGTTGGGGTAGATGG + Intronic
1029888793 7:103904604-103904626 TTTATTAAGGAGTTAGGAAATGG + Intronic
1030400611 7:109044151-109044173 TTTATCAAGGAGCTGGTACAGGG + Intergenic
1031985693 7:128163393-128163415 TGTATGAAGGAGGTGGTGAAAGG + Intergenic
1032472442 7:132188419-132188441 TTCTTTAAGGAGGAGGTAGCTGG - Intronic
1032812896 7:135440535-135440557 CTTAGTTAGGAGGTGGTATAAGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033550894 7:142446832-142446854 TTTTTTAAAAAGGTGGTAAAAGG - Intergenic
1034076576 7:148237442-148237464 TTTATTATGGAAGAGGGAGAAGG + Intronic
1035910919 8:3565446-3565468 TTTATTAAGGAGGCGATTCACGG - Intronic
1037833937 8:22205233-22205255 GTTACTAAGGAGGTGAGAGATGG + Intronic
1038623829 8:29171093-29171115 TTCATTAGGGAGGTGGCAGTAGG + Intronic
1039169670 8:34728700-34728722 TTTAACAAGGAGGTTGTGGAAGG + Intergenic
1040297383 8:46163236-46163258 TTAATTAAGAAGTTGGAAGAAGG - Intergenic
1043469330 8:80546903-80546925 TTTTTCAAGGAGGTGGAAAAAGG - Intergenic
1044389545 8:91633438-91633460 TGAATTAAGGAGGTGTTACAAGG - Intergenic
1045460011 8:102417265-102417287 TTTATTTAGGAGGTGATTGCAGG + Intergenic
1046969703 8:120208223-120208245 TTTAAACAGGTGGTGGTAGATGG + Exonic
1047165807 8:122437287-122437309 TTGATTATGGAGGTGGGGGAGGG - Intergenic
1048188846 8:132269831-132269853 TTTGTTCAAGAGCTGGTAGAGGG + Intronic
1048736742 8:137510410-137510432 TTTATAAATGAGGAGGTTGATGG - Intergenic
1049484344 8:142845646-142845668 TTCTTGAAGGAGGTGTTAGATGG + Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1052043246 9:23765432-23765454 TCTCTTAAGGATGTGGGAGAAGG + Intronic
1052375924 9:27717426-27717448 TTTATGAATGAGGAGGTTGAAGG - Intergenic
1057013638 9:91631127-91631149 TTTATCATGGTGGTGTTAGAGGG - Intronic
1059478697 9:114571014-114571036 TTTATTAAGGAGGTCTTGGCCGG + Intergenic
1061164927 9:128916730-128916752 TGGATGAAGGAGGTGGGAGATGG - Exonic
1061690618 9:132325449-132325471 TTTCTTGAGGAGGTGGCAAAGGG - Intronic
1189003659 X:36972371-36972393 TTTATTAAGGAGGTGTTCCAAGG - Intergenic
1190502210 X:51090561-51090583 TTTATTTTGGTGATGGTAGAAGG - Intergenic
1191936459 X:66432671-66432693 TTTATGAAGGAAGAGGCAGAAGG + Intergenic
1192494182 X:71603528-71603550 CATATAAAGGAGGTGGTAGAGGG + Intronic
1192972899 X:76252571-76252593 TTTATTGAGGATGTGTTTGAGGG + Intergenic
1193645072 X:84057670-84057692 TTTATTAAGGGGCTGGGAGATGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194062410 X:89220888-89220910 TTTATTAAGCAGTTTGAAGATGG + Intergenic
1195346051 X:103952357-103952379 GTTTTTAGGGAGGTGGGAGAGGG + Intronic
1195361558 X:104087168-104087190 GTTTTTAGGGAGGTGGGAGAGGG - Intergenic
1195766227 X:108298816-108298838 TTTATGAAGGAGGAGGAAGAGGG + Intronic
1197295597 X:124715540-124715562 TTTATACAGGAGGGGGTAGTGGG + Intronic
1197304809 X:124828982-124829004 ATTATTATGGAAGTAGTAGATGG + Intronic
1200716280 Y:6549855-6549877 TTTATTAAGCAGTTTGAAGATGG + Intergenic
1200797700 Y:7356723-7356745 TTTATTAAGGTTGTGGCAGTAGG + Intergenic
1201339669 Y:12920619-12920641 TTAATGACGAAGGTGGTAGAAGG + Intergenic
1201540360 Y:15099413-15099435 GATATTATGGAGGTGTTAGAAGG + Intergenic