ID: 1148501780

View in Genome Browser
Species Human (GRCh38)
Location 17:48097108-48097130
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337978
Summary {0: 3899, 1: 24362, 2: 59781, 3: 92583, 4: 157353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501780_1148501788 28 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501788 17:48097159-48097181 CAGGAGAATCACTTGAACCGAGG 0: 475
1: 57011
2: 130808
3: 165988
4: 198564
1148501780_1148501786 9 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128
1148501780_1148501785 5 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501785 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 42
2: 304
3: 1181
4: 5196
1148501780_1148501781 -5 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501781 17:48097126-48097148 GCCTGTAATTCCAGCTACTTAGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
1148501780_1148501783 -2 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501783 17:48097129-48097151 TGTAATTCCAGCTACTTAGGAGG 0: 165
1: 9002
2: 124152
3: 249909
4: 274939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501780 Original CRISPR CAGGCGCCTGCCACCACGCC TGG (reversed) Intronic