ID: 1148501781

View in Genome Browser
Species Human (GRCh38)
Location 17:48097126-48097148
Sequence GCCTGTAATTCCAGCTACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942647
Summary {0: 2083, 1: 44834, 2: 172258, 3: 271952, 4: 451520}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501780_1148501781 -5 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501781 17:48097126-48097148 GCCTGTAATTCCAGCTACTTAGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
1148501773_1148501781 28 Left 1148501773 17:48097075-48097097 CCCCATCTCTACTAAAAAAATAC 0: 873
1: 2689
2: 10935
3: 114372
4: 215310
Right 1148501781 17:48097126-48097148 GCCTGTAATTCCAGCTACTTAGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
1148501774_1148501781 27 Left 1148501774 17:48097076-48097098 CCCATCTCTACTAAAAAAATACA 0: 924
1: 3422
2: 11034
3: 122620
4: 288957
Right 1148501781 17:48097126-48097148 GCCTGTAATTCCAGCTACTTAGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520
1148501775_1148501781 26 Left 1148501775 17:48097077-48097099 CCATCTCTACTAAAAAAATACAA 0: 2411
1: 2540
2: 15396
3: 234157
4: 170002
Right 1148501781 17:48097126-48097148 GCCTGTAATTCCAGCTACTTAGG 0: 2083
1: 44834
2: 172258
3: 271952
4: 451520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501781 Original CRISPR GCCTGTAATTCCAGCTACTT AGG Intronic
Too many off-targets to display for this crispr