ID: 1148501783

View in Genome Browser
Species Human (GRCh38)
Location 17:48097129-48097151
Sequence TGTAATTCCAGCTACTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658167
Summary {0: 165, 1: 9002, 2: 124152, 3: 249909, 4: 274939}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501774_1148501783 30 Left 1148501774 17:48097076-48097098 CCCATCTCTACTAAAAAAATACA 0: 924
1: 3422
2: 11034
3: 122620
4: 288957
Right 1148501783 17:48097129-48097151 TGTAATTCCAGCTACTTAGGAGG 0: 165
1: 9002
2: 124152
3: 249909
4: 274939
1148501775_1148501783 29 Left 1148501775 17:48097077-48097099 CCATCTCTACTAAAAAAATACAA 0: 2411
1: 2540
2: 15396
3: 234157
4: 170002
Right 1148501783 17:48097129-48097151 TGTAATTCCAGCTACTTAGGAGG 0: 165
1: 9002
2: 124152
3: 249909
4: 274939
1148501780_1148501783 -2 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501783 17:48097129-48097151 TGTAATTCCAGCTACTTAGGAGG 0: 165
1: 9002
2: 124152
3: 249909
4: 274939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501783 Original CRISPR TGTAATTCCAGCTACTTAGG AGG Intronic
Too many off-targets to display for this crispr