ID: 1148501784

View in Genome Browser
Species Human (GRCh38)
Location 17:48097136-48097158
Sequence CCTCAGGCCTCCTAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5900
Summary {0: 2, 1: 43, 2: 293, 3: 1100, 4: 4462}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501784_1148501788 0 Left 1148501784 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 43
2: 293
3: 1100
4: 4462
Right 1148501788 17:48097159-48097181 CAGGAGAATCACTTGAACCGAGG 0: 475
1: 57011
2: 130808
3: 165988
4: 198564
1148501784_1148501790 6 Left 1148501784 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 43
2: 293
3: 1100
4: 4462
Right 1148501790 17:48097165-48097187 AATCACTTGAACCGAGGAGGCGG 0: 56
1: 14955
2: 56083
3: 94151
4: 105415
1148501784_1148501791 9 Left 1148501784 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 43
2: 293
3: 1100
4: 4462
Right 1148501791 17:48097168-48097190 CACTTGAACCGAGGAGGCGGAGG 0: 24
1: 7049
2: 42996
3: 108232
4: 151876
1148501784_1148501789 3 Left 1148501784 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 43
2: 293
3: 1100
4: 4462
Right 1148501789 17:48097162-48097184 GAGAATCACTTGAACCGAGGAGG 0: 107
1: 23687
2: 90160
3: 152121
4: 170464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501784 Original CRISPR CCTCAGGCCTCCTAAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr