ID: 1148501785

View in Genome Browser
Species Human (GRCh38)
Location 17:48097136-48097158
Sequence CCAGCTACTTAGGAGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6725
Summary {0: 2, 1: 42, 2: 304, 3: 1181, 4: 5196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501780_1148501785 5 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501785 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 42
2: 304
3: 1181
4: 5196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501785 Original CRISPR CCAGCTACTTAGGAGGCCTG AGG Intronic
Too many off-targets to display for this crispr