ID: 1148501786

View in Genome Browser
Species Human (GRCh38)
Location 17:48097140-48097162
Sequence CTACTTAGGAGGCCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3136
Summary {0: 2, 1: 41, 2: 209, 3: 756, 4: 2128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501780_1148501786 9 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128
1148501782_1148501786 -10 Left 1148501782 17:48097127-48097149 CCTGTAATTCCAGCTACTTAGGA 0: 161
1: 8858
2: 122955
3: 249956
4: 275165
Right 1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501786 Original CRISPR CTACTTAGGAGGCCTGAGGC AGG Intronic
Too many off-targets to display for this crispr