ID: 1148501788

View in Genome Browser
Species Human (GRCh38)
Location 17:48097159-48097181
Sequence CAGGAGAATCACTTGAACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552846
Summary {0: 475, 1: 57011, 2: 130808, 3: 165988, 4: 198564}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148501784_1148501788 0 Left 1148501784 17:48097136-48097158 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 43
2: 293
3: 1100
4: 4462
Right 1148501788 17:48097159-48097181 CAGGAGAATCACTTGAACCGAGG 0: 475
1: 57011
2: 130808
3: 165988
4: 198564
1148501782_1148501788 9 Left 1148501782 17:48097127-48097149 CCTGTAATTCCAGCTACTTAGGA 0: 161
1: 8858
2: 122955
3: 249956
4: 275165
Right 1148501788 17:48097159-48097181 CAGGAGAATCACTTGAACCGAGG 0: 475
1: 57011
2: 130808
3: 165988
4: 198564
1148501780_1148501788 28 Left 1148501780 17:48097108-48097130 CCAGGCGTGGTGGCAGGCGCCTG 0: 3899
1: 24362
2: 59781
3: 92583
4: 157353
Right 1148501788 17:48097159-48097181 CAGGAGAATCACTTGAACCGAGG 0: 475
1: 57011
2: 130808
3: 165988
4: 198564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148501788 Original CRISPR CAGGAGAATCACTTGAACCG AGG Intronic
Too many off-targets to display for this crispr