ID: 1148509478

View in Genome Browser
Species Human (GRCh38)
Location 17:48156483-48156505
Sequence CTTGAGCTGCATCCTGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148509473_1148509478 8 Left 1148509473 17:48156452-48156474 CCACTGAAGAGCGCTAAACACCC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG 0: 1
1: 0
2: 2
3: 16
4: 222
1148509472_1148509478 21 Left 1148509472 17:48156439-48156461 CCACAATCTGGAGCCACTGAAGA 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG 0: 1
1: 0
2: 2
3: 16
4: 222
1148509471_1148509478 27 Left 1148509471 17:48156433-48156455 CCAGCGCCACAATCTGGAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG 0: 1
1: 0
2: 2
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148509478 Original CRISPR CTTGAGCTGCATCCTGGCTC CGG Intronic
900213214 1:1467580-1467602 CGTGAGATGAATCCTGCCTCTGG + Intronic
900218441 1:1494690-1494712 CGTGAGATGAATCCTGCCTCTGG + Intronic
900220778 1:1508401-1508423 CGTGAGATGAATCCTGCCTCTGG + Intergenic
900225783 1:1533113-1533135 CGTGAGATGAATCCTGCCTCTGG + Intronic
901203031 1:7477320-7477342 CCTAAGCTGCCTCCTGGGTCTGG + Intronic
902193897 1:14783711-14783733 CTTGAGCGGGGTCCTGGCTGAGG + Intronic
902711886 1:18246128-18246150 CTTGAGCAGCATCCCAGCTCTGG + Intronic
902823213 1:18956122-18956144 CTTCCGCTGCTTCCTGGCTAAGG - Exonic
902834121 1:19035800-19035822 GCTGAGCTGCGCCCTGGCTCTGG - Intergenic
902931512 1:19734778-19734800 CTGGGCCTGAATCCTGGCTCTGG + Intronic
903024612 1:20418469-20418491 CCTGAGGTGCATCCTGGAGCTGG + Intergenic
903681624 1:25101258-25101280 CTGAGGCTGCTTCCTGGCTCAGG - Intergenic
905285680 1:36878719-36878741 CTGTAGGTGCATGCTGGCTCTGG + Intronic
905513223 1:38540957-38540979 CTGGATTTGAATCCTGGCTCTGG - Intergenic
905823907 1:41015193-41015215 CTCCAGCTGCTTCCTGCCTCTGG - Intergenic
906296689 1:44653010-44653032 CTTGAGCTGTCTCATGGCACAGG + Intronic
910924694 1:92386373-92386395 CTTGAACTTCATCCTGACTGAGG + Intronic
911086221 1:93979541-93979563 CTTGAGCCTGGTCCTGGCTCTGG + Intergenic
911720740 1:101188698-101188720 CTTGAAGTGAATCCTTGCTCAGG + Intergenic
912929197 1:113941282-113941304 CTTGAGCTTCATCAAGGCTGTGG - Exonic
917131364 1:171745267-171745289 CTTTGGATGCATCCTGGCCCAGG - Intergenic
917487187 1:175465993-175466015 CTTGACCTCCATTCTGCCTCTGG + Intronic
922022076 1:221715813-221715835 CCTGAGGGGCTTCCTGGCTCTGG - Intronic
922537770 1:226394798-226394820 CTGGATTTGAATCCTGGCTCAGG + Intronic
1064229964 10:13521272-13521294 CCTGGCTTGCATCCTGGCTCTGG + Intronic
1067682851 10:48451246-48451268 CTTGAGGGGCGGCCTGGCTCTGG - Intronic
1067750162 10:48966435-48966457 CTGTAGCTGCACCCTGTCTCTGG - Intronic
1070475771 10:76827689-76827711 CTTGCTCTACATCATGGCTCTGG + Intergenic
1070663931 10:78330149-78330171 CAGGAGCTGCCTCCTGGCTTTGG - Intergenic
1070760797 10:79023227-79023249 CTTGAGTTCTGTCCTGGCTCTGG + Intergenic
1070784974 10:79157633-79157655 CTTGGCCTGCACCCTGGCCCAGG + Intronic
1071552003 10:86573432-86573454 CTAGACCTGGGTCCTGGCTCAGG - Intergenic
1075923369 10:126231725-126231747 CCTGAACTGCCTCCTGCCTCGGG + Intronic
1079095317 11:17506183-17506205 CTTGAGCTAGAGCCTGGCTTGGG + Intronic
1079106614 11:17576178-17576200 CTGGTGCTGCATCCTGACACAGG - Intronic
1079122084 11:17693259-17693281 ATTTAGCTGCAGTCTGGCTCAGG - Intergenic
1080955643 11:37091858-37091880 GTTTTTCTGCATCCTGGCTCTGG - Intergenic
1081782480 11:45722765-45722787 TTTGAGCATCCTCCTGGCTCTGG - Intergenic
1082085257 11:48044710-48044732 CTTGGCCTGCATCCTCTCTCTGG - Intronic
1084674153 11:70624448-70624470 CTGGGGGTGAATCCTGGCTCAGG - Intronic
1085466734 11:76729103-76729125 CTTTAGCTGGATCCTGGATTTGG + Intergenic
1085517762 11:77121477-77121499 CACAAGCTGCCTCCTGGCTCTGG - Intronic
1088148352 11:106713102-106713124 CTTGAGAGGCATCCAGGCTGTGG - Intronic
1088882464 11:113982694-113982716 CTTGTGTTCCATCCTGACTCTGG - Intronic
1090870867 11:130746301-130746323 CTTGGGCTCTATTCTGGCTCTGG - Intergenic
1094288472 12:28819372-28819394 CATGAGCTGGAACCTGGCCCTGG + Intergenic
1096211136 12:49766830-49766852 CCTGACCTACATCCTGGCTATGG + Intergenic
1097732842 12:63150053-63150075 CTTGCTCTGCACCCTTGCTCTGG + Exonic
1098378427 12:69842627-69842649 CTTCACCTGCCTCCTGGCTGTGG + Intronic
1100427127 12:94497878-94497900 CTTGAGCTGGAACCTGACACTGG - Intergenic
1101411311 12:104470785-104470807 CTGGAACAGGATCCTGGCTCAGG + Intronic
1102905373 12:116670534-116670556 CCTGAGCTGCAGCCTGCCTCGGG - Intergenic
1103487753 12:121294887-121294909 CATGAGCTGCCACCTGGCCCTGG - Intronic
1111777047 13:92677691-92677713 CATGGTCTGCGTCCTGGCTCAGG + Intronic
1114529708 14:23388114-23388136 CTTGCCCTGCATGCTGGCTGCGG + Intronic
1114535060 14:23417462-23417484 CTTGCCCTGCATGCTGGCTGCGG + Intronic
1115573140 14:34686011-34686033 CTTGTGCTGTTTCCTGGCACAGG - Intergenic
1116277425 14:42853518-42853540 CCTAAGCTGCTTCCTGACTCTGG - Intergenic
1122362224 14:101174276-101174298 CCTGAGCTCCTGCCTGGCTCAGG + Intergenic
1122885471 14:104708562-104708584 CTTGGGCTCCTTCCTGGCCCGGG - Exonic
1123759664 15:23422610-23422632 CCTGGACGGCATCCTGGCTCGGG + Intergenic
1124123016 15:26908424-26908446 ATTGGGCTGCAGCCTGACTCTGG - Intronic
1124177786 15:27442237-27442259 ATTTAGCTGAATCCTGGCTATGG - Intronic
1124411111 15:29438078-29438100 CTGGATCCGCATCCTGCCTCCGG + Intronic
1124972237 15:34499354-34499376 CATGGTCTGCGTCCTGGCTCAGG + Intergenic
1131052477 15:89357953-89357975 CTGGGGCTGCATTGTGGCTCCGG + Intergenic
1131890803 15:96969656-96969678 CTCGATGTGAATCCTGGCTCAGG - Intergenic
1132546867 16:537238-537260 CTTGAGCTGGAGCCAGTCTCAGG - Intronic
1133344260 16:5059714-5059736 CTGGAGCTGCATCCTCACTGGGG + Intronic
1134241473 16:12510032-12510054 CTGGAGCTGCAACATGGCACTGG - Intronic
1135764435 16:25165355-25165377 CTTGGGTTGAATCCTGGCCCTGG + Intronic
1136711232 16:32238841-32238863 TCTGAGCTTCATCCTGCCTCTGG + Intergenic
1136756675 16:32690566-32690588 TCTGAGCTTCATCCTGCCTCTGG - Intergenic
1136811435 16:33179809-33179831 TCTGAGCTTCATCCTGCCTCTGG + Intergenic
1136817911 16:33289889-33289911 TCTGAGCTTCATCCTGCCTCTGG + Intronic
1136824475 16:33346418-33346440 TCTGAGCTTCATCCTGCCTCTGG + Intergenic
1136829541 16:33445189-33445211 TCTGAGCTTCATCCTGCCTCTGG + Intergenic
1137444348 16:48522730-48522752 CTAGAGCTGAATTCTAGCTCAGG + Intergenic
1137521533 16:49199364-49199386 CTCCCGCTGCCTCCTGGCTCTGG + Intergenic
1138205339 16:55120343-55120365 CTCAAGCTGCCTCCTGGCCCTGG - Intergenic
1141967607 16:87457132-87457154 CTGGAGCTGCAGCCAGGCACTGG + Intronic
1142110151 16:88326992-88327014 TTTGAGCTGTCTCCTGGGTCAGG + Intergenic
1142222756 16:88863680-88863702 CTTGTGCTCCATCCTGGGGCTGG - Exonic
1202990013 16_KI270728v1_random:2778-2800 TCTGAGCTTCATCCTGCCTCTGG + Intergenic
1203058824 16_KI270728v1_random:950918-950940 TCTGAGCTTCATCCTGCCTCTGG - Intergenic
1143594099 17:7903892-7903914 CCTCAGTTGCATCCTGGTTCCGG - Exonic
1143777627 17:9209795-9209817 CCTGAGCTACATTCTGTCTCAGG - Intronic
1144946511 17:18972144-18972166 GATGAGCTGCTTCCTGTCTCTGG + Intronic
1145208999 17:20999457-20999479 CCAGAGCTGCAGCCTGGCTTTGG - Intergenic
1146006946 17:29166393-29166415 CTGGTGCAGCATCCTGGCCCAGG - Exonic
1146633097 17:34484675-34484697 GCTGAGCTGCATCCTGGGTAAGG + Intergenic
1147314385 17:39612622-39612644 CTGCAGCTTCTTCCTGGCTCTGG + Intergenic
1147573901 17:41587861-41587883 CTGGAGCTGCATCCAGGAACAGG + Intergenic
1147600201 17:41740436-41740458 CCTGAGCTACCTCCAGGCTCAGG + Intergenic
1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG + Intronic
1151231961 17:72691243-72691265 CTTGAGCTCAATCCTGGCTCAGG + Intronic
1151537630 17:74747953-74747975 CTGGAGCTGCACCCAGGCTTTGG + Intergenic
1151883851 17:76911857-76911879 CATGAACTGAATCCTGGCGCTGG + Intronic
1152353996 17:79797967-79797989 CCTGGGCTGCAGCCGGGCTCCGG - Intronic
1156439666 18:37171589-37171611 CCTGAGCTTAATCCTGGCACTGG + Intronic
1160805293 19:989924-989946 CTGGAACTGCACCCGGGCTCAGG + Intronic
1161767352 19:6214963-6214985 CTGCAGCTGCCTCCCGGCTCTGG + Intronic
1162479422 19:10920018-10920040 CTGCAGCTGCAACCTGGCTGGGG + Intronic
1162530844 19:11235682-11235704 CCTGGGCTGCCTCCAGGCTCCGG + Exonic
1162531717 19:11239883-11239905 CCTGGGCTGCATCCCGGCCCCGG - Exonic
1164401329 19:27904342-27904364 CCTGAGCTGCAGCCTGCCCCGGG - Intergenic
1166902564 19:46077101-46077123 GCTCAGCTGCATCCTGACTCTGG - Intronic
1167245954 19:48373326-48373348 CCTCTGCTCCATCCTGGCTCAGG - Intronic
1167796903 19:51715382-51715404 CTTGAGCCCCATCCTACCTCAGG + Intronic
1168156105 19:54473728-54473750 ACTGAGCTGCATCCTGCCTTGGG - Intergenic
1168637720 19:58009502-58009524 CAGGCGCTGCATCCTGGCTCCGG + Exonic
928329391 2:30346310-30346332 GCTGGGCTGAATCCTGGCTCTGG - Intergenic
929571816 2:43027400-43027422 AATGAGCTGCACCCTGGCCCTGG - Intergenic
930895778 2:56444459-56444481 CTGGAGCTCTAGCCTGGCTCAGG + Intergenic
932192368 2:69751720-69751742 CATGTGCTGCATCATGACTCTGG + Intronic
932713973 2:74088206-74088228 CTTGAGCTGGGTTCTAGCTCTGG + Intronic
934612441 2:95751320-95751342 CATGAGCTGCATCCTGCCTTGGG - Intergenic
934648477 2:96073100-96073122 CATGAGCTGCATCCTGCCTTGGG + Intergenic
934841711 2:97628124-97628146 CATGAGCTGCATCCTGCCTTGGG + Intergenic
935109629 2:100080717-100080739 CTTTGGCTGCATCCTGGCCGGGG - Intronic
935471031 2:103461286-103461308 CTAGAGCTGCATCCTTTCTAGGG + Intergenic
935602755 2:104939655-104939677 CTTAAACTGCAACCTGGCACTGG - Intergenic
936058955 2:109282090-109282112 CTCTAGTTGCATTCTGGCTCAGG + Intronic
941868749 2:170361684-170361706 CTTGACCTGCTACTTGGCTCTGG + Intronic
943006864 2:182395647-182395669 CTTGCACAGCAGCCTGGCTCTGG - Intronic
945125563 2:206505840-206505862 TTTCATCTGCATTCTGGCTCTGG + Intronic
948237213 2:236400213-236400235 CTGGAGCTGCAGCCTGACTCTGG + Intronic
1169391250 20:5193019-5193041 TTTAAGCTCCAACCTGGCTCAGG - Exonic
1169523141 20:6394442-6394464 CTGGAGCTGCCCACTGGCTCAGG - Intergenic
1171452642 20:25247280-25247302 CTGGAGCTGCAGCCTGGATTGGG + Intergenic
1171464786 20:25319871-25319893 CTGGAGCTGCAGCCTGGATTGGG - Intronic
1172501645 20:35432215-35432237 TTTGAGCTGCCTCCTTGGTCTGG - Intergenic
1173315892 20:41942792-41942814 CCTGGCCTGCATCCTCGCTCTGG + Intergenic
1173658065 20:44714717-44714739 CTTGGCCTGCCTCCCGGCTCTGG - Intergenic
1173712808 20:45175485-45175507 CTTGAGCCCCATCCTGGCTCTGG - Intronic
1174093438 20:48068227-48068249 CCTGGGCTGCATGCTAGCTCCGG + Intergenic
1175278525 20:57787879-57787901 CTTGAGGAGCATCCTGGCAATGG - Intergenic
1179143401 21:38747100-38747122 CTAGTGCTGCTTCCTTGCTCTGG - Intergenic
1179181223 21:39046841-39046863 CTTGAAATGCATGCTTGCTCAGG - Intergenic
1179568486 21:42263878-42263900 CTTGAGCAACATCCCGTCTCAGG - Intronic
1180077153 21:45468718-45468740 CTGGAGCTGGAGCCTGGCGCCGG + Exonic
1181046833 22:20218618-20218640 CTGGAGCTCCTTCCCGGCTCCGG + Intergenic
1181434053 22:22900159-22900181 CTGGGTCTGGATCCTGGCTCTGG - Intergenic
1181434991 22:22905525-22905547 CTGGGTCTGGATCCTGGCTCTGG - Intergenic
1183541872 22:38434088-38434110 CTGGAGCTGCTGCCTGGCTCTGG - Intronic
1184099087 22:42332289-42332311 CCTGAGCTGCTTCCTACCTCAGG - Intronic
1184458029 22:44622331-44622353 CTGGAGCTGCTGGCTGGCTCTGG + Intergenic
1184658810 22:45955886-45955908 CCTGAGGTGCATCCTGGCGCAGG + Intronic
1185211521 22:49573254-49573276 CTTGCTCTGCCTCCTGCCTCAGG - Intronic
1185225256 22:49648340-49648362 GATGAGCTGCATCCAGGCTGCGG - Intronic
950465511 3:13151002-13151024 CTGCAGCTCCATCCTGGCCCAGG - Intergenic
951356604 3:21674633-21674655 TTTGAGCTGCATCCTGCACCAGG - Intronic
953045743 3:39292750-39292772 CTGGAGCTGCAGTCTGACTCTGG + Intergenic
954441312 3:50523734-50523756 CTTAGCCTGCGTCCTGGCTCAGG + Intergenic
954692416 3:52402605-52402627 CTTTATCTCCATGCTGGCTCAGG - Exonic
955103096 3:55870928-55870950 CTTGAGCAGCATTCTAGCCCTGG - Intronic
955884233 3:63580461-63580483 CTTGTACTGCATCATGGGTCTGG - Intronic
960053704 3:113261240-113261262 CCAGAGCTGGATCCTGGCACAGG - Intronic
962006672 3:131356707-131356729 CTTTAGCTGTATCATGGCACTGG + Intergenic
962621230 3:137181774-137181796 CTTGAATTGAATCCTTGCTCAGG + Intergenic
963611989 3:147481303-147481325 GTTGCTCTGCATCCTGGCTCTGG - Intronic
964018374 3:151976243-151976265 CTTAAGCTGCTTCCTGGCTGAGG + Intergenic
966824640 3:183953449-183953471 CCTGGGCTTCATCCTGGGTCTGG - Intronic
966833999 3:184035479-184035501 CTTGAGCTTGAGCTTGGCTCAGG - Intronic
967009954 3:185423434-185423456 CTTGAGCTGTCTCCTGCCTTTGG - Intronic
968179215 3:196578711-196578733 CTTGGGCTGCATGCAGGCTGTGG - Intronic
969132729 4:5003635-5003657 CTTGCACTGCAGCCTGGCTTGGG - Intergenic
969246222 4:5934646-5934668 CTTGTGCTCCAGCCTGGCTATGG - Intronic
969277618 4:6147577-6147599 CTTGAGCTGGATCCTGAGCCTGG - Intronic
969844218 4:9907329-9907351 CTGGATTTGAATCCTGGCTCCGG - Intronic
969964911 4:10984154-10984176 CTGGAGCTGCACCCAGTCTCTGG + Intergenic
970377905 4:15477685-15477707 TCTGAGCTGCATCCTCACTCTGG - Intronic
975747753 4:77491610-77491632 CATGTGCTGCATCCTTGTTCTGG + Intergenic
977566948 4:98590246-98590268 ATTGGGCAGCTTCCTGGCTCAGG - Intronic
979541232 4:121885381-121885403 CTTTAGCTGCTGTCTGGCTCTGG + Intronic
982126494 4:152188369-152188391 CCTGAGCTGAGTCCTGGCCCAGG + Intergenic
986585121 5:9308417-9308439 CTAGAGCTGCATCTGGGATCGGG + Intronic
986790727 5:11157052-11157074 CTTGAGCCACATCCTGACTCTGG - Intronic
987069565 5:14323019-14323041 CTGCAGCTCCATCCTGGCTGTGG - Intronic
989003828 5:36788095-36788117 TTTGAACTGCATCTTGGTTCAGG - Intergenic
989678561 5:44002913-44002935 TTTCAGCAGCATCCTGGTTCAGG + Intergenic
992002790 5:72451924-72451946 CCTGAGGTGCCTCCAGGCTCTGG - Intronic
992075646 5:73190442-73190464 TCTGAGTTGCATCCTGGCTTGGG - Intergenic
992468814 5:77033466-77033488 CTTGCCCTAAATCCTGGCTCTGG - Intronic
993974114 5:94455939-94455961 CTTGGGCTGTATCCAGACTCTGG - Intronic
997712135 5:136014837-136014859 CTTGAGCTGAGGCCAGGCTCAGG + Intergenic
998761573 5:145438071-145438093 CAGAAGCTGCTTCCTGGCTCAGG - Intergenic
998808897 5:145946074-145946096 CATGAGCTGCTTCCTGCATCTGG + Intronic
999005415 5:147971267-147971289 CTTGATTTTAATCCTGGCTCTGG + Intergenic
1002286483 5:178165876-178165898 CCTGGGCTTCCTCCTGGCTCAGG - Intergenic
1002711847 5:181199874-181199896 TTTGAGCTGTCTCCTGGATCTGG + Exonic
1003571535 6:7259421-7259443 CCTGAGCTTCTTCCTGGCCCCGG - Intergenic
1005475144 6:26200438-26200460 TTAGTGCTGCATCCAGGCTCGGG - Intergenic
1007886247 6:45233322-45233344 ATGGAGCTGCATCCTGTCTTCGG - Intronic
1008086642 6:47252643-47252665 CTGGATTTGAATCCTGGCTCTGG - Intronic
1014024866 6:116633957-116633979 CATCAGCTGCATCCTGGCAAAGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1018683452 6:166283770-166283792 CGTGTGCTGCATCTTGGCTGTGG + Intergenic
1019352484 7:561505-561527 CCTGAGCTGCGTGCAGGCTCCGG + Intronic
1019814959 7:3192915-3192937 CTTCAGCCTCATCCTGGCTTAGG + Intergenic
1022422915 7:30240981-30241003 CTTGAGCTGCTTGCTGCCCCTGG - Intergenic
1022998596 7:35784466-35784488 CTGAAGCTGCATCCTGGTGCCGG + Intergenic
1023015787 7:35968041-35968063 CTTCAGCTGCAGCCTGTCACTGG + Intergenic
1023870754 7:44261960-44261982 CTGGGGCTGCAGCCTGGCCCCGG + Intronic
1024675182 7:51631831-51631853 GTGGTGCTGCGTCCTGGCTCAGG + Intergenic
1025715409 7:63951407-63951429 TTTGAGCACCATCCTGCCTCTGG - Intergenic
1026946037 7:74316882-74316904 CGTGAGCTGCATGCTGACTATGG - Intronic
1028116913 7:87008378-87008400 CTTAGGCTGCATCCTGGATTGGG + Intronic
1030270076 7:107661186-107661208 CTGGAGCTGCGTCCCGGGTCAGG + Intronic
1033725972 7:144118921-144118943 GTTCAGCTTCCTCCTGGCTCTGG - Intergenic
1033726987 7:144129559-144129581 GTTCAGCTTCCTCCTGGCTCTGG + Exonic
1034555078 7:151845309-151845331 CTTGAGCTGCAAGAGGGCTCCGG + Intronic
1034967277 7:155399105-155399127 CCTCAGCTCCAGCCTGGCTCCGG - Intergenic
1035474930 7:159136601-159136623 GGTGAGCTGCATGCTGGCTGTGG + Intronic
1035600235 8:892941-892963 CCTGGTCTGCATCCTGCCTCTGG + Intergenic
1035717794 8:1767052-1767074 CTTGGGCTGGATCCTGCCTCTGG + Intronic
1037664228 8:20954331-20954353 CCTGAGCTGCTTCCTGACTCAGG - Intergenic
1037781496 8:21872368-21872390 CTTTTCCTGCCTCCTGGCTCTGG + Intergenic
1040373135 8:46796651-46796673 TTTCAACTCCATCCTGGCTCTGG + Intergenic
1042189799 8:66174494-66174516 CTGGAGCTGCAGCCTGTCCCTGG - Exonic
1042510222 8:69603378-69603400 CTTCAGCTGCTGGCTGGCTCTGG - Intronic
1042666357 8:71210783-71210805 CTTAGGCTGCGTCCAGGCTCAGG + Intronic
1045062122 8:98419582-98419604 CCTGGGCTGCATCCTGGACCTGG + Intronic
1045337161 8:101216435-101216457 TTTGAGCTTCCTGCTGGCTCTGG - Intergenic
1048305915 8:133284642-133284664 AGTGAGCTGCATCCTGGGTATGG - Intronic
1049638242 8:143700915-143700937 CTTGGGCTGCGTCCTGTCACAGG - Intronic
1051410822 9:16787884-16787906 CTGAAGCTGCATCCTGGCTAAGG - Intronic
1052195322 9:25706146-25706168 CTGGAGTTGGATCCTGGATCAGG + Intergenic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1062099766 9:134721941-134721963 CTAGACCTGGATCCTGGCCCAGG - Intronic
1062120833 9:134833278-134833300 AGTGAGATGCATCATGGCTCAGG + Intronic
1062537042 9:137025609-137025631 CCTGGGCTCCGTCCTGGCTCAGG - Intronic
1186812663 X:13205588-13205610 CATGAGTTGCTTACTGGCTCTGG + Intergenic
1187339473 X:18408466-18408488 CTGGAGCTTCATCCTGGGTTCGG + Intergenic
1190530403 X:51368904-51368926 AGTGAGCTACATTCTGGCTCAGG - Intergenic
1192758071 X:74066731-74066753 CTTCACCTGCATCATGTCTCTGG - Intergenic
1199514033 X:148655682-148655704 CTTGAGCTGCATCCACATTCAGG + Intronic
1200898866 Y:8407254-8407276 TTTAAGCTCCATCCTGGCTCTGG - Intergenic
1202249085 Y:22851331-22851353 TTTAAGCTCCATCGTGGCTCTGG - Intergenic
1202402073 Y:24485079-24485101 TTTAAGCTCCATCGTGGCTCTGG - Intergenic
1202468709 Y:25185004-25185026 TTTAAGCTCCATCGTGGCTCTGG + Intergenic