ID: 1148512862

View in Genome Browser
Species Human (GRCh38)
Location 17:48187924-48187946
Sequence GATCTAAACAGAACAGCAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148512859_1148512862 0 Left 1148512859 17:48187901-48187923 CCACTCCGATCCAAAGAAACTAT 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1148512857_1148512862 29 Left 1148512857 17:48187872-48187894 CCTCTGCTGACAACACACCATCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1148512861_1148512862 -10 Left 1148512861 17:48187911-48187933 CCAAAGAAACTATGATCTAAACA 0: 1
1: 0
2: 1
3: 23
4: 307
Right 1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1148512860_1148512862 -5 Left 1148512860 17:48187906-48187928 CCGATCCAAAGAAACTATGATCT 0: 1
1: 0
2: 1
3: 26
4: 308
Right 1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1148512858_1148512862 12 Left 1148512858 17:48187889-48187911 CCATCGCTTCTGCCACTCCGATC 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148512862 Original CRISPR GATCTAAACAGAACAGCAGT AGG Exonic
901275108 1:7985118-7985140 GCTCTAAACAAAACAGTGGTAGG + Exonic
906127219 1:43434348-43434370 AATCTGACCAGAACTGCAGTGGG - Intronic
906356559 1:45111359-45111381 CATAGAAACAAAACAGCAGTGGG + Intronic
906511358 1:46412011-46412033 GATCTGAACAGAGCCACAGTGGG - Intronic
909618043 1:77634846-77634868 AAACTAAACAGAAGAGGAGTCGG - Intronic
910035164 1:82779886-82779908 AACCTAAAAAGAGCAGCAGTGGG + Intergenic
913342528 1:117772984-117773006 GATCAAAACTGATTAGCAGTGGG - Intergenic
918116306 1:181501068-181501090 GAAGAAAACAAAACAGCAGTGGG - Intronic
918723785 1:187891510-187891532 GATGGAGACAGAACAGTAGTAGG - Intergenic
918874640 1:190024694-190024716 GATGCAAACACAACACCAGTAGG - Intergenic
919260185 1:195182412-195182434 GATCTAAATCAAAAAGCAGTCGG - Intergenic
920519489 1:206612678-206612700 GAAATAAACAGAACAGCTATTGG - Intergenic
921248806 1:213277167-213277189 GTTGTAAACAGAATAGCAGCAGG + Intergenic
1063933753 10:11055859-11055881 GATTTAAATAATACAGCAGTTGG - Intronic
1064013061 10:11751233-11751255 GATCTAAACAGCATAGCCATGGG + Intronic
1064178442 10:13095629-13095651 GAACTAGACCGAACAGCAGGAGG - Intronic
1064848661 10:19685424-19685446 GATTTAATGAGAACAGCTGTAGG + Intronic
1070389567 10:75957679-75957701 GATTTAAGGAGAACAGCAATGGG + Intronic
1071517926 10:86311371-86311393 GACCTAATCAGGACAGCAGATGG + Intronic
1074501348 10:114027852-114027874 GATCTAATCAGGAGGGCAGTGGG + Intergenic
1080153177 11:29077042-29077064 GCTCTGGACAGAACAGCAGGAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084438216 11:69156280-69156302 GAGCTACAGAGAACAGCAATGGG - Intergenic
1085021292 11:73211008-73211030 GATATAAACAAAAAAGTAGTGGG + Intergenic
1089784345 11:120897203-120897225 AATCTAAACTCAACAGCAATGGG - Intronic
1091588689 12:1830325-1830347 GATGGAAACATAACAGCACTTGG + Intronic
1092948698 12:13480398-13480420 ACTATAAAAAGAACAGCAGTAGG + Intergenic
1093713871 12:22359692-22359714 TGTCTAAACAGAACAGCCTTGGG - Intronic
1095218719 12:39582035-39582057 AGTCTAAACAGAACTTCAGTAGG + Intronic
1095323160 12:40854787-40854809 GAGCTAATCAGAAGAGCAGATGG + Intronic
1096798165 12:54091436-54091458 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1097995422 12:65882561-65882583 GATTAAAACCAAACAGCAGTGGG - Intronic
1098216839 12:68229503-68229525 GAAAGACACAGAACAGCAGTGGG + Intergenic
1099852219 12:88115339-88115361 AATCTAAACAGTAAAGCAGATGG + Intronic
1108055633 13:46482183-46482205 GATCTAGAAAGAGCAGCTGTGGG - Intergenic
1109642835 13:65212850-65212872 GATATAAACAGAATATAAGTAGG + Intergenic
1111916604 13:94367515-94367537 AATCTAACCTGAACAGCAGTAGG + Intronic
1118059730 14:62122353-62122375 GAACCAAACAGAACACCATTAGG - Intergenic
1120077642 14:80177615-80177637 AAACAAAACATAACAGCAGTTGG - Intergenic
1128153090 15:65375852-65375874 GATCTAAACAGATGAGAAATGGG - Intronic
1130920939 15:88344083-88344105 GATCTCATGAGAACAGCAGCAGG + Intergenic
1132938134 16:2492459-2492481 TTTCTAAACAGAACAGGAGCTGG - Intronic
1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG + Exonic
1157174992 18:45443555-45443577 GATTTACACAGAAAGGCAGTGGG + Intronic
1158345780 18:56515550-56515572 GAACAAAAAAGAACAGCAGCAGG - Intergenic
1160486465 18:79297847-79297869 GACCTTAACAGAACAGCCCTGGG + Intronic
1162342335 19:10098999-10099021 GATCTAAGCAGAAGAGCAGACGG - Intronic
1165229645 19:34378908-34378930 CAACCAAAGAGAACAGCAGTGGG - Intronic
925696571 2:6586295-6586317 GATATAAAGAGAATAGAAGTAGG + Intergenic
927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG + Intergenic
928019012 2:27686348-27686370 GATATAAACAGGTCAGCAGGAGG + Intronic
931672607 2:64661907-64661929 TAACAGAACAGAACAGCAGTGGG - Intronic
932004074 2:67910778-67910800 GCTCTAAACAGGACAGCAGCTGG + Intergenic
932020686 2:68083024-68083046 GAACTAAACTGCACAGCAGGAGG + Intronic
933037071 2:77413246-77413268 GACCTAAAAAGAACATGAGTAGG + Intronic
937635826 2:124154319-124154341 GAGATAAACGGAACAGTAGTAGG + Intronic
937874778 2:126815199-126815221 CATCTAGACAGAAGAGCAGTAGG - Intergenic
942128681 2:172855026-172855048 GATCTAAAAATCACTGCAGTTGG + Intronic
942162282 2:173203512-173203534 TATCTAAACAGAACTACAGTAGG - Intronic
943554855 2:189390129-189390151 GATCAAAATAGAGCAGAAGTAGG + Intergenic
945016233 2:205520056-205520078 GATCTCTCCAGAGCAGCAGTGGG - Intronic
947478327 2:230472550-230472572 GATATAAACAGAAAAACAGGTGG + Intronic
1169830484 20:9819894-9819916 GATCTAAACCCAAGAGCTGTAGG + Intronic
1170300286 20:14876126-14876148 TGTCAAAACAGAACAGAAGTTGG - Intronic
1171849995 20:30301256-30301278 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1173386134 20:42589739-42589761 GATCAAAACAGATCAGGAGCTGG - Intronic
1176280713 20:64307478-64307500 GATCAGACCAGAACAGCACTTGG + Intergenic
1178065653 21:28901930-28901952 GATCAAAACAATACAGCAGAAGG - Intergenic
1180139182 21:45880895-45880917 GGGTTAAACAGCACAGCAGTGGG + Intronic
1182252513 22:29012302-29012324 GATCTAAACAGTGAAGCAGAGGG + Intronic
953232134 3:41074665-41074687 GAAATAAGGAGAACAGCAGTTGG - Intergenic
959019447 3:101172255-101172277 CAACAAAACAGATCAGCAGTGGG + Intergenic
959455478 3:106555014-106555036 GAAATAAACAGAACAGCAGTGGG + Intergenic
959510817 3:107209664-107209686 GATCTAAAGACAACATCAGATGG - Intergenic
960280868 3:115780306-115780328 GTTTTAGAAAGAACAGCAGTGGG + Intergenic
961358821 3:126355263-126355285 GATCTAAAAAGTACAGTAGGGGG + Intronic
964784838 3:160384875-160384897 GATCTACGCAGAACACCACTAGG + Intronic
967193570 3:187006347-187006369 GATCTACACAGAACACAAATTGG + Intronic
967723976 3:192844455-192844477 AAGCTAAAGAGCACAGCAGTGGG - Intronic
968385554 4:133496-133518 GATCTCAACAGAACTTCAGTAGG - Intronic
970120450 4:12747231-12747253 CATCTTTCCAGAACAGCAGTCGG + Intergenic
970343277 4:15128930-15128952 GTTGTAAACAGAACAGAATTGGG + Intergenic
972098430 4:35380010-35380032 AATCAAAACAAAAAAGCAGTTGG - Intergenic
972509691 4:39756864-39756886 GAACAAAATAGAACAGCAGTTGG + Intronic
972852399 4:43067471-43067493 GATCTAAACAGAACATTTGTAGG - Intergenic
975791216 4:77953916-77953938 GATTTAAGCAGAACAGCCTTGGG - Intergenic
976606392 4:86987418-86987440 GATCTGAACATAACAGCTCTGGG + Intronic
978162014 4:105559915-105559937 GAACTGAACAGAAGAGAAGTTGG - Intronic
978350117 4:107812531-107812553 TATCTAAACTGTATAGCAGTTGG + Intergenic
980190808 4:129522590-129522612 GAACTGAAAAGAACAGAAGTTGG + Intergenic
982154357 4:152501883-152501905 GATTTAATCAGAAAAGCATTTGG - Intronic
984090605 4:175369689-175369711 AATTTAAACCAAACAGCAGTAGG - Intergenic
988783620 5:34545770-34545792 GACATAAACAGAGCAGCAGAGGG - Intergenic
988983126 5:36591558-36591580 CATTAAAACTGAACAGCAGTGGG - Intergenic
990648669 5:57873426-57873448 GAAGTAAACATAACAGCAGAAGG - Intergenic
994305052 5:98192924-98192946 GATCTCATGAGAACAGCAGTGGG + Intergenic
994512113 5:100717569-100717591 AATTTAAACAGAACAGCATCTGG + Intergenic
995100610 5:108298433-108298455 AATCTAAACAAAACTTCAGTAGG + Intronic
995305867 5:110648924-110648946 GTTCTCAACAGAACAGAAATGGG - Intronic
996148447 5:120005028-120005050 GATCTCAACAGAACAACTGTTGG + Intergenic
996499529 5:124201960-124201982 AAACTAAACAGAACAAAAGTAGG + Intergenic
1000745536 5:165028032-165028054 GATCTAAAATGGAAAGCAGTTGG + Intergenic
1003606278 6:7564123-7564145 CTTGAAAACAGAACAGCAGTAGG - Intronic
1005014086 6:21361018-21361040 AGTCCAACCAGAACAGCAGTGGG + Intergenic
1005169532 6:22966874-22966896 TATCTAATCAACACAGCAGTGGG - Intergenic
1010185268 6:73136592-73136614 AATTTCAACAGAACAGCAATTGG - Intronic
1011402000 6:86973415-86973437 GCTGTAATCAGCACAGCAGTGGG - Intronic
1012022679 6:93945023-93945045 GATTTAATCAGAGGAGCAGTTGG - Intergenic
1012564131 6:100624615-100624637 GTTCTAAAAAGAAAATCAGTGGG - Intronic
1014694815 6:124606896-124606918 CAATTAAACAGAACAACAGTTGG + Intronic
1014944416 6:127479512-127479534 AATCTAACCAAAACAGCAGTGGG + Intronic
1016050255 6:139523137-139523159 GTTCTAAACAGGACTGGAGTAGG + Intergenic
1018598803 6:165515890-165515912 AATATAAATAGAACAGCAGTGGG - Intronic
1020911805 7:14140510-14140532 GATCCAAGCTGAACAGCAGGAGG - Intergenic
1022123154 7:27329523-27329545 GACTTAGACAGGACAGCAGTGGG + Intergenic
1024609326 7:51050370-51050392 GTTTTTAAAAGAACAGCAGTTGG - Intronic
1025063518 7:55832252-55832274 GATATAAACACAACAGATGTTGG + Intronic
1025791378 7:64690351-64690373 AATCTGAACAGAACTGCAGCTGG - Exonic
1027122078 7:75529002-75529024 AATTTAAAAAGAACAGTAGTTGG - Intergenic
1030661043 7:112219931-112219953 AATCTAAACAGCATAGCAGCTGG - Intronic
1041500498 8:58534144-58534166 AGTCTAACCAGAACAGCATTAGG + Intergenic
1046046901 8:108975405-108975427 GCTCTATACAAAACACCAGTGGG + Intergenic
1048645956 8:136419422-136419444 GATCTAAATAATACATCAGTTGG - Intergenic
1048773056 8:137916172-137916194 TATCTAAAGAGAACAGAAGGTGG + Intergenic
1048808961 8:138267832-138267854 GGTCTAAATAGAACTGCATTAGG - Intronic
1048984524 8:139727952-139727974 GAATTAAAAAGAACAGCAATGGG + Intergenic
1049296287 8:141841547-141841569 GATCTCAACAGAACAGTGGCTGG - Intergenic
1052626257 9:30980886-30980908 GATCTCCACAGAGCTGCAGTGGG + Intergenic
1053787770 9:41664549-41664571 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054157356 9:61650218-61650240 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054176046 9:61875891-61875913 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054477130 9:65581223-65581245 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054661493 9:67704917-67704939 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1056206461 9:84323961-84323983 GATTTAGAAAGCACAGCAGTGGG - Intronic
1057448380 9:95135239-95135261 GATGTAAACAAAAGAGCAATTGG - Intronic
1060051947 9:120384046-120384068 GTTCCAAACAGAACAGCATGTGG - Intergenic
1190356401 X:49609581-49609603 CACATAAACAGAAGAGCAGTTGG + Intergenic
1191188882 X:57643801-57643823 GATCTTAACACAATAACAGTTGG + Intergenic
1195479824 X:105331529-105331551 TTTGTAAACAGAACAGCAGGTGG + Intronic
1196187665 X:112761971-112761993 GAAAGAAACAGAAAAGCAGTGGG + Intergenic
1198146269 X:133860416-133860438 GAACAAAACTGAACAGCACTCGG + Intronic
1200173309 X:154095149-154095171 GATTTAAACAGCACAGAAGTCGG + Intronic