ID: 1148514108

View in Genome Browser
Species Human (GRCh38)
Location 17:48199988-48200010
Sequence AAGAATTAGATTGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148514104_1148514108 14 Left 1148514104 17:48199951-48199973 CCAGGGTTTTCATGGCAATTGTC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148514108 Original CRISPR AAGAATTAGATTGAGGAGGA AGG Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900883313 1:5397852-5397874 GAGCCTTAGAATGAGGAGGAAGG - Intergenic
902146578 1:14406150-14406172 AAAAAGTAGATTGTGGAGAATGG - Intergenic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
907080929 1:51621149-51621171 AATAATTCAATAGAGGAGGAAGG - Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
908146058 1:61245235-61245257 CAGAATTAAATTGAGGGGCATGG + Intronic
908625239 1:66032948-66032970 AAGAATTAGATAAATGAGGCCGG - Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
909859410 1:80586143-80586165 AAAAATTAGATGGGGGAGGAGGG + Intergenic
910077441 1:83297908-83297930 AAGATTTACTTTGAGAAGGAGGG + Intergenic
910632332 1:89368852-89368874 AAGAATTGGAATGAGAAGGTTGG - Intronic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912595989 1:110876510-110876532 GAGAACTAGATTGAGGAATAGGG + Intronic
913014990 1:114723882-114723904 ATGATTGAGATTGTGGAGGAGGG - Exonic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913647111 1:120868742-120868764 AAGAAAAACATTGAGGAGAAAGG + Intergenic
913678410 1:121164808-121164830 AATGATCAGATTGAGGATGATGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914030248 1:143952446-143952468 AATGATCAGATTGAGGATGATGG - Intronic
914079531 1:144394123-144394145 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914159202 1:145115505-145115527 AATGATCAGATTGAGGATGATGG + Intergenic
914174429 1:145262666-145262688 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914529101 1:148503842-148503864 AAGAAAAACATTGAGGAGAAAGG - Intergenic
914991892 1:152505963-152505985 AAGAATTCCATAGAGTAGGATGG - Intergenic
915106254 1:153536658-153536680 AAGATTTTGATGGAGGAGGCAGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
916569165 1:166009747-166009769 AAGAATCAGCTTTAGGGGGAAGG - Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
918779200 1:188674605-188674627 AAAAATGAAATTGAGGTGGAGGG - Intergenic
918951147 1:191140608-191140630 AAGAATTAAAATGAGCAGCAGGG - Intergenic
919112571 1:193239201-193239223 AAGAAATAGTTTGAGGAATAAGG - Intronic
919993311 1:202724583-202724605 AAAAATTAGTTTGGGGATGAGGG - Exonic
920035409 1:203061915-203061937 AAGAATGAGACTGAGGAGAAGGG - Intronic
920459863 1:206131159-206131181 AGGAGTTAGAGAGAGGAGGAGGG + Intergenic
920465715 1:206183332-206183354 AATGATCAGATTGAGGATGATGG - Intergenic
920719788 1:208376428-208376450 GAGAAGTAGATGGTGGAGGATGG - Intergenic
921303011 1:213768386-213768408 AAAAAATAGAATGAGGAGAAAGG + Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
1063885035 10:10568737-10568759 AAAAATGTGAGTGAGGAGGAGGG + Intergenic
1063991623 10:11571067-11571089 AAGAATTATTTTGGGGAGGGAGG - Intronic
1064371489 10:14755571-14755593 CAGGATTAAATTGAGGATGATGG - Intronic
1066221857 10:33343041-33343063 AAGGAGTAGATTGAGGAAGGAGG + Intergenic
1066617219 10:37307687-37307709 CAGAATTAGAGTGAGGGGGTGGG + Intronic
1066668538 10:37812250-37812272 AAGAAAATCATTGAGGAGGAAGG + Intronic
1067345901 10:45439036-45439058 AAGACTTAGAATAAGGAGGTGGG + Intronic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1069957094 10:72058821-72058843 AAAAATTAGGCTGAGAAGGAGGG - Intergenic
1070238671 10:74656136-74656158 AATGATCAGATGGAGGAGGATGG + Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1074058098 10:109940876-109940898 CAGAATTAGATAGAAGAGGAGGG - Intergenic
1074213385 10:111360073-111360095 AAGAATGACATTGAGCAGAAAGG - Intergenic
1074233894 10:111565606-111565628 AAGAATTTGATTCAGGAAGTTGG + Intergenic
1074620882 10:115119837-115119859 AAAAATTAGGTTGAGGCAGAAGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077842455 11:5990565-5990587 AAGAAGGAGATTGAGGAGAGAGG - Intergenic
1077958696 11:7049587-7049609 AAGAATTAGATTGAAAAGAAAGG + Intronic
1078297618 11:10089801-10089823 AAGAATTATATTAAGTAGAAAGG + Intronic
1078446021 11:11405429-11405451 AGGAATGAGATGGAGGTGGAAGG + Intronic
1078465778 11:11549350-11549372 TAGAATTAGATTTAGCAGCAGGG - Intronic
1078486535 11:11728311-11728333 AAGAATAATTTTGAGGAGCAAGG - Intergenic
1078749184 11:14143634-14143656 AAGAATTAGACTGAGTTGCAGGG + Intronic
1079096629 11:17514855-17514877 AATAATTAGATTAAGGAATAGGG + Intronic
1079711146 11:23683269-23683291 GAGAACTAGAATGAGGAAGACGG + Intergenic
1079826060 11:25195021-25195043 AAGAAGTAGATGGCAGAGGAAGG - Intergenic
1080836158 11:35943206-35943228 AAGACTTAGATGGTGGAAGAAGG - Intergenic
1080947806 11:36994726-36994748 AAAAATTATATTGAGAAGGGGGG - Intergenic
1082561575 11:54626227-54626249 AAACATGAGATTGGGGAGGATGG - Intergenic
1082668327 11:56003468-56003490 AAAAAATAAATAGAGGAGGAAGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1085651044 11:78268974-78268996 AAGCAAGAGATGGAGGAGGAAGG + Intronic
1086240880 11:84689423-84689445 AAATATTCTATTGAGGAGGAGGG - Intronic
1086477792 11:87198173-87198195 AAGAATAGAACTGAGGAGGATGG - Intronic
1086663006 11:89444935-89444957 AAAAATTATTTTGAGGAGGTTGG + Intronic
1086827552 11:91518314-91518336 AAGAAATAGATTAAGGTGGTTGG - Intergenic
1087291734 11:96327724-96327746 AAGAAATACATTGAAGAGTATGG - Intronic
1087613941 11:100467114-100467136 AAGATTTAGATGAAGGAGGAGGG - Intergenic
1088062415 11:105671274-105671296 AAGAAATAGCTTGAGGAAAAAGG + Intronic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088946777 11:114521838-114521860 AAGAATCTGTTTGGGGAGGAAGG - Exonic
1090088126 11:123669250-123669272 AAGCAATTGAGTGAGGAGGAAGG + Intergenic
1090674303 11:128974864-128974886 GACAATGAGAGTGAGGAGGAAGG - Exonic
1091136980 11:133200458-133200480 AAGAATGAGATTGCTGAGGGTGG - Intronic
1092477482 12:8831460-8831482 GAGAAATAGAGTGGGGAGGAAGG - Intronic
1094061198 12:26316763-26316785 AAAAATAACAGTGAGGAGGAGGG - Intergenic
1094224725 12:28032215-28032237 AAGAATGATATTGAGAATGAGGG - Intergenic
1094582709 12:31749163-31749185 AGGCAATAGAGTGAGGAGGACGG + Intergenic
1094766346 12:33599287-33599309 AAGATTTAGATTTAGGATGAAGG - Intergenic
1095142132 12:38677015-38677037 AGGAATTATAATGAGCAGGATGG + Intronic
1095218130 12:39574392-39574414 AAGAATTTGATTCTGGAGTATGG - Intronic
1095546010 12:43371222-43371244 AAAAATGAGTTTTAGGAGGAGGG - Intronic
1096067974 12:48756177-48756199 TAGAAATAGACTGAGGAGGCCGG - Intergenic
1096226992 12:49872400-49872422 GAGAAGTGGATAGAGGAGGAAGG + Intronic
1096948283 12:55434580-55434602 AAGAATTACATTTTGGAGGGTGG + Intergenic
1097237806 12:57551591-57551613 AAAAACTAGCTTGAGGAGGGAGG + Intronic
1097575409 12:61387221-61387243 AAGTCTAAGATTGATGAGGATGG + Intergenic
1098174052 12:67772631-67772653 AAGCATTAGATGGAGGAAGCAGG - Intergenic
1098331481 12:69358440-69358462 AAGAATTACATTTAGAAGGATGG - Intergenic
1098352864 12:69582280-69582302 AAGACTTTGAGGGAGGAGGAAGG + Intergenic
1098713436 12:73798348-73798370 AATAATTAAATTTAGGAGGTGGG + Intergenic
1099050245 12:77773658-77773680 AAGAATGCTATTGAGGAGTATGG + Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099614643 12:84919055-84919077 GAGAAGTAGATGGAGAAGGAAGG - Intergenic
1100105503 12:91166791-91166813 AAGAATTAGAATCCTGAGGATGG - Intronic
1100602061 12:96120655-96120677 AAGAAAAAGATGGAAGAGGAGGG + Intergenic
1101382518 12:104226572-104226594 GAGAATTAGAGTGAAGAGAACGG + Intronic
1101410674 12:104465349-104465371 AAGAGTTAGAATGGGGAGGGTGG + Intronic
1101683691 12:106995282-106995304 AAGAATTAGTTTTGGGAGAAGGG - Intronic
1102230389 12:111257695-111257717 AAGATGGAGAATGAGGAGGAAGG - Intronic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1103257164 12:119551621-119551643 ATGAATGAGAGTCAGGAGGAAGG - Intergenic
1103653735 12:122454098-122454120 AAGAATCAGATACAGGAAGAGGG - Intergenic
1103757011 12:123216249-123216271 CAGATTTATATTGAAGAGGAGGG - Intronic
1104550046 12:129748350-129748372 GAGAATGAGACTGAGGAGGGAGG + Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106492618 13:30241228-30241250 ATGAATTAAATAGAGGAGAATGG - Intronic
1106925270 13:34606866-34606888 AAGAGATATATTGAGGATGAGGG + Intergenic
1107568942 13:41635822-41635844 AAGAATTAGACAGCGCAGGAGGG + Intronic
1107798585 13:44081163-44081185 ATGAATTTTATTGAGCAGGAAGG - Intergenic
1107956206 13:45514532-45514554 CAGAATTAGATAAAAGAGGATGG - Intronic
1107959221 13:45543826-45543848 AAGAGTTTGTTTGAGGAGGAGGG + Intronic
1108018654 13:46102181-46102203 AGGAATTAGAGAGTGGAGGAGGG - Intronic
1108276415 13:48814579-48814601 AAGAAGTGGAAGGAGGAGGAGGG - Intergenic
1108598699 13:51972342-51972364 AAGAATTAGAGGGAGGAGGAGGG - Intronic
1109464748 13:62715668-62715690 AAGAAAATGATTGAGGAGAAAGG + Intergenic
1109641447 13:65197311-65197333 AAGAACTAGATTTGGAAGGAAGG + Intergenic
1110291255 13:73809140-73809162 GAGAGTTAGGTTGAGAAGGATGG - Intronic
1110336483 13:74337911-74337933 AAGTATTAGAATGTGAAGGAAGG + Intergenic
1110912419 13:80981157-80981179 AAGAAAGAGAGAGAGGAGGAAGG + Intergenic
1111378652 13:87415550-87415572 AAGAATTAAATTTTGGTGGAAGG - Intergenic
1111597053 13:90425768-90425790 ATGAATTAGATTTTTGAGGATGG - Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112204544 13:97311066-97311088 AATTATTAGATTAAGGAGTATGG - Intronic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113595943 13:111532897-111532919 ACGAAGCAGAGTGAGGAGGAAGG - Intergenic
1113756435 13:112814790-112814812 AAAAAGAAGATTGAGGGGGAAGG - Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1117394559 14:55296271-55296293 AAAAATTAGATTCAGCAGGAAGG + Intronic
1117419594 14:55531046-55531068 AAGATTGAGACAGAGGAGGAAGG + Intergenic
1118298938 14:64597115-64597137 AACAATCATATTGAGGATGAAGG - Intergenic
1119216027 14:72869709-72869731 AAGAAGGGGATTGAGGAGGTTGG - Intronic
1120511574 14:85421878-85421900 AAGAAGTAGAATGGGGAGGAGGG - Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121068435 14:90993072-90993094 AAGAAGTAGTTTTAGGAAGAAGG - Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1124989078 15:34652901-34652923 GATAATGAGTTTGAGGAGGAAGG + Intergenic
1125400231 15:39294554-39294576 AAAAAACAAATTGAGGAGGAGGG - Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1128027204 15:64448057-64448079 GAGAATGAAATGGAGGAGGAAGG - Intronic
1128702769 15:69816265-69816287 AAGGTTTAGAGTGAGGAGAAGGG - Intergenic
1128990882 15:72259516-72259538 AAGTATTTGATTGAGGAGCTGGG + Intronic
1130293729 15:82627436-82627458 ACGAATTAGATAAAGTAGGAAGG + Intronic
1130439385 15:83936384-83936406 AATAATTAGAATGAGAAGAATGG + Intronic
1131558015 15:93415879-93415901 TGGAATTGGAGTGAGGAGGAAGG + Intergenic
1132095667 15:98982666-98982688 AATAACCAGAGTGAGGAGGAAGG - Intronic
1133149933 16:3820426-3820448 AAGACTTCAATTGAGGGGGAAGG - Intronic
1134855729 16:17517398-17517420 AAGAAATAGACTGAGGATAAAGG + Intergenic
1134861349 16:17563280-17563302 AATAATTAGACTGAGAAGAATGG + Intergenic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1135525842 16:23212995-23213017 AAGAATTACCTTGTGGAGGCTGG + Intronic
1135619097 16:23937969-23937991 GAGAATCAGATTGTGGAGGTGGG + Intronic
1135673916 16:24398213-24398235 AAGAATTAGATTGAACAGAAAGG + Intergenic
1135844369 16:25905325-25905347 AAAAATTAGATAGGGGCGGAGGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1137914231 16:52411371-52411393 TAGAATTAGAATGAGGGAGAAGG - Intergenic
1138626549 16:58256493-58256515 AAGCATGACATTGAGGAGGCCGG + Intronic
1138934948 16:61707562-61707584 AAGAAGTAGATAGAGAAGGCAGG - Intronic
1139201340 16:64980608-64980630 AAGAATGAGATGGAGGTAGAGGG + Intronic
1139263827 16:65621492-65621514 AAGAATCAGACTAAGAAGGAAGG + Intergenic
1139425065 16:66874063-66874085 AAGAAGGAGGTAGAGGAGGAGGG - Intergenic
1140757074 16:78077132-78077154 AAGAACTAGATTGAGCATGGAGG - Intergenic
1140918428 16:79514689-79514711 CAGAATTGGATAGAGAAGGATGG - Intergenic
1141901206 16:86992097-86992119 AAGAAACAGATAGAGGAGGCTGG + Intergenic
1142781339 17:2183299-2183321 AAAAATTAAAGTGAGCAGGAGGG + Intronic
1144413419 17:15022926-15022948 AAGAAATAAATTGAAGAGAAAGG + Intergenic
1145742713 17:27289402-27289424 AAGAATGAGATTCAAGAGAATGG + Intergenic
1145745547 17:27317111-27317133 AAAAAATAGATTAAGGATGATGG + Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146548786 17:33762351-33762373 AAGAATTTGAATAAGGGGGAAGG + Intronic
1146687171 17:34848933-34848955 AAGAATTGGGGTGAGAAGGAGGG + Intergenic
1146726521 17:35160804-35160826 AAGAAGTTGATTGAGGAGAGGGG - Intronic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1149184503 17:53981394-53981416 TGGAATTGAATTGAGGAGGAGGG - Intergenic
1149544054 17:57489919-57489941 AGGAATTAGGGTGAGCAGGAGGG + Intronic
1150777121 17:68090056-68090078 AAGAATTGCACTGAGGATGAGGG - Intergenic
1151677984 17:75609650-75609672 AAGAAAGAGAGAGAGGAGGAGGG - Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1155510227 18:26568939-26568961 AACAATTTGATTTAAGAGGAAGG + Intronic
1155592230 18:27440475-27440497 AAAAAGTAGATTGAAGTGGAGGG - Intergenic
1156003023 18:32406841-32406863 AAGTATAAGACTGAAGAGGAAGG + Intronic
1156356410 18:36346011-36346033 AAGAAATAGATTCAGGGGGCTGG - Intronic
1156585196 18:38424280-38424302 AAGAAAGAGATGGAGGAGGGTGG - Intergenic
1156862054 18:41848837-41848859 AAGACTTAAATTCAGGTGGATGG + Intergenic
1156895792 18:42244144-42244166 AGGAAAGAGATTGTGGAGGATGG - Intergenic
1156999706 18:43510038-43510060 AAGATTTAGAAGGAGAAGGAGGG + Intergenic
1157227421 18:45879885-45879907 AAGAATTAGACTCAGGGGAATGG + Intronic
1157541907 18:48516688-48516710 AGGAATCAGATCTAGGAGGAAGG + Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1158316898 18:56221299-56221321 GAGAATTAGATTGTGCAGGCAGG + Intergenic
1159216477 18:65397884-65397906 AAGAATTAGATTCAAGGAGAGGG + Intergenic
1159272897 18:66176027-66176049 AAGAATTACATTAAGCAGGCCGG + Intergenic
1161085591 19:2333511-2333533 AAGCATTAAATTGAAGAGGTGGG + Intronic
1161254376 19:3298908-3298930 AAGAAATAGAGAGAGAAGGAAGG + Intergenic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161860151 19:6791948-6791970 AAGAATGAGGTTTGGGAGGAAGG + Intronic
1162689032 19:12413769-12413791 AAGAGTTAGGTTGAGGAGACAGG + Intronic
1164082232 19:21868536-21868558 AAGAAGTAGAATGAGGAAAAAGG - Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1165422932 19:35731432-35731454 AAGAAGTGGACAGAGGAGGAGGG + Intronic
1166006059 19:39907672-39907694 TAGAATTAGAGTGAAGAGGCCGG + Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166605105 19:44135047-44135069 AATAAATAAATTGATGAGGATGG + Intergenic
1167716647 19:51146611-51146633 AAGAATGGGAGGGAGGAGGAAGG - Intronic
1168082111 19:54017721-54017743 AAGAAGTAAAAGGAGGAGGAGGG - Intergenic
1202638100 1_KI270706v1_random:59216-59238 AAGATGGAGATTGGGGAGGATGG - Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
924970284 2:120044-120066 AAGAATTTGTTAGAGGAGGAAGG + Intergenic
925256739 2:2496283-2496305 AAGAACTAGAGGGAGGAGGCGGG + Intergenic
925399648 2:3563214-3563236 ATGACTTAGGTTTAGGAGGACGG - Intergenic
926092023 2:10057617-10057639 AAGAAGGAGATAGAGGGGGAAGG - Exonic
926452158 2:13018445-13018467 AAGAAAACCATTGAGGAGGAAGG + Intergenic
926523586 2:13948163-13948185 ATGAAATAAATTGAGGAAGATGG - Intergenic
927923842 2:26995647-26995669 AAAAAATAAATGGAGGAGGAAGG + Intronic
928159058 2:28905054-28905076 AAGATTTGGATAGAGGAGGGTGG + Intronic
928159238 2:28906892-28906914 AAGATTTGGATAGAGGAGGGTGG + Intronic
928405242 2:31009779-31009801 GAGATTTAGAATGAGGAAGAAGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929396585 2:41530861-41530883 AAGTAATAGAAAGAGGAGGAGGG + Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930833432 2:55770061-55770083 AAGAAAGAGAGAGAGGAGGAAGG - Intergenic
931165663 2:59744896-59744918 AACTATAACATTGAGGAGGAAGG + Intergenic
931549620 2:63428191-63428213 AAAAAAAAAATTGAGGAGGAGGG + Intronic
931700008 2:64901818-64901840 GAGAAGTAGATGGAGGAAGACGG + Intergenic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
932311753 2:70748228-70748250 AATACTTGGAGTGAGGAGGAGGG - Intronic
932558208 2:72843975-72843997 AAAAATTAGATTGCCTAGGATGG - Intergenic
933803170 2:85979078-85979100 AAGAATGAGAAAGAGAAGGAAGG - Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934602627 2:95669520-95669542 AAGTCTGAGATTGAGGAGTAGGG + Intergenic
934873590 2:97891824-97891846 AGGAATTAGATTCTGGAGGTGGG - Intronic
934884412 2:98012046-98012068 AAGAAGTAGAAGGAGCAGGAAGG + Intergenic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935133636 2:100279692-100279714 AAGAGCCAGATAGAGGAGGATGG - Exonic
937197233 2:120169628-120169650 AAGACTGAGGTTGCGGAGGAAGG - Intronic
937270758 2:120650066-120650088 TAGAACTAGATTGATCAGGAAGG + Intergenic
937618714 2:123959883-123959905 AATAATTCGATTAAGAAGGAAGG - Intergenic
937706737 2:124929585-124929607 AATAATTATATTGTGGAGAAGGG + Intergenic
937720646 2:125091321-125091343 AAGAAATAGGTTTTGGAGGAAGG + Intergenic
938125230 2:128666307-128666329 AATAAATAGATGGAAGAGGATGG - Intergenic
938642232 2:133293173-133293195 AAGGTTTAGAGTGAAGAGGAAGG + Intronic
938750497 2:134324363-134324385 AAGAACTAGATTGACAAGTAAGG - Intronic
939114735 2:138047526-138047548 TAGACTAAGATTGAGGATGAAGG + Intergenic
939686852 2:145210889-145210911 ATAAATTATATTGAGCAGGATGG + Intergenic
939722296 2:145668924-145668946 AAGTATTAGCTTAAGGGGGAGGG - Intergenic
939821411 2:146961050-146961072 AAGAATTTGATGGTGGAGGGTGG + Intergenic
940745163 2:157559713-157559735 GAAAATTAGATTGAAGAGGATGG + Intronic
941033660 2:160541918-160541940 CAGCATTAGAATGTGGAGGAGGG - Intergenic
941239715 2:163021544-163021566 AAGAATTAGACTGATCAGAAGGG + Intergenic
941583761 2:167331662-167331684 TAGTATTGGATTGGGGAGGAGGG + Intergenic
942200638 2:173567610-173567632 AAGAAGTAGATTGAGAAGACAGG - Intergenic
942275016 2:174314785-174314807 AAGATTTATATTGAGGATAAAGG - Intergenic
942365382 2:175220811-175220833 AAGAAAGAGAGAGAGGAGGAGGG - Intergenic
943212273 2:184982485-184982507 AAGCAGTAGATTAAGGATGAGGG - Intergenic
943601944 2:189931620-189931642 AAGAGTTTGCTTGAGGAGGGAGG - Intronic
943659877 2:190547868-190547890 AAAAATTCGATAAAGGAGGATGG + Intergenic
944183280 2:196919751-196919773 AAGAATAAGATAGAGTAGGATGG - Intronic
944340320 2:198588567-198588589 AAGCATAAGATTGAGGAAGTAGG + Intergenic
944364924 2:198906612-198906634 AAGAATTAGACTGAGGCAGTTGG + Intergenic
945411331 2:209511988-209512010 AAAGATTAGAATTAGGAGGAAGG - Intronic
945446320 2:209942172-209942194 AGGCATTAGATTCAGGAGCATGG - Intronic
945460981 2:210108061-210108083 AAGAAAAAAATTGAGAAGGATGG - Intronic
946132783 2:217620309-217620331 AAGAATTATATTGACAATGAAGG - Intronic
946175561 2:217920067-217920089 GACAATTAGGTGGAGGAGGAGGG - Intronic
947136734 2:226983444-226983466 AAGAAATGGATTGAGGTGGCTGG - Intronic
947286757 2:228525329-228525351 AAGAATGAGAGGGAGGAGGGAGG + Intergenic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170646988 20:18206616-18206638 AATTATTAGAGTGAGGAGGGAGG + Intergenic
1170812186 20:19682808-19682830 AAGAATTACTTTGAAGAGGAAGG - Intronic
1170845412 20:19957990-19958012 AAGAACTAGATGGAGAAGCAAGG + Intronic
1173070271 20:39757706-39757728 CAGAAGTAGAGTGAGGAGTAAGG + Intergenic
1173317634 20:41959397-41959419 AGGAAAGAGATTGATGAGGAGGG - Intergenic
1173670643 20:44796405-44796427 AGGAAATAGAGTGGGGAGGAAGG + Intronic
1174390597 20:50216409-50216431 AAGATTCAGAGTCAGGAGGAAGG + Intergenic
1175185481 20:57177202-57177224 AAGAAGAGGGTTGAGGAGGAAGG + Intronic
1175831816 20:61968793-61968815 TAGAATTTGTTTGAGAAGGATGG - Intronic
1175831819 20:61968836-61968858 TAGAATTTGTTTGAGAAGGATGG - Intronic
1177923235 21:27181170-27181192 AAAAATTAGTTAGAGGAGGGTGG - Intergenic
1178288311 21:31344359-31344381 AAGAATTAAATTGGAGAGGGAGG - Intronic
1178456651 21:32760546-32760568 AAGAATTATTTTGAAGAAGATGG - Intronic
1179269361 21:39838544-39838566 AAGAATTAGATGGAAAATGATGG + Intergenic
1179347034 21:40568153-40568175 AAGAATTTGATACAGGAAGAAGG - Intronic
1182050649 22:27310422-27310444 AAGAAAGAGATGGAGGAAGATGG + Intergenic
1182677311 22:32049773-32049795 AAGACTTAGATGAAGGAGGCAGG - Intronic
1182741131 22:32568219-32568241 AGGAATTAGGTAGAGGAGCAAGG - Intronic
951109013 3:18779139-18779161 TAGAAATAGATTCAGGAGAATGG - Intergenic
952173056 3:30830562-30830584 AGAGATTAGATAGAGGAGGAAGG - Intronic
952576781 3:34783541-34783563 AGAGATTAGATGGAGGAGGAGGG - Intergenic
952579296 3:34812307-34812329 AAGAAATAAATTGATGAGGAAGG + Intergenic
952604625 3:35130128-35130150 AAGAATGAGAGTGAAGTGGAGGG + Intergenic
952875829 3:37943499-37943521 AAAAATCAGACTTAGGAGGAAGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955146581 3:56326032-56326054 AAGAAGGAGAGTGAGGAGTAGGG - Intronic
955344302 3:58149745-58149767 TAGAAATAGATTGAGGCGTAAGG + Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955913099 3:63878622-63878644 AAGAATTATTTTCAGAAGGACGG + Intronic
956060195 3:65341164-65341186 AAGAATGAGATGGGAGAGGAGGG + Intergenic
956117020 3:65929253-65929275 TTGAGTTAGATTGAGGAGAAAGG - Intronic
957562874 3:81846504-81846526 AAGTTTCAGGTTGAGGAGGATGG - Intergenic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
958734760 3:97995616-97995638 AAGAATTAGAGTGGAGAGGAGGG + Intronic
959468083 3:106714767-106714789 AAGAATAACATGGAGAAGGAAGG - Intergenic
959685987 3:109147102-109147124 AAAAATTGGATTTAGCAGGATGG - Intergenic
960337663 3:116437640-116437662 AAGAATTGGAGGGAGGAGGAAGG + Intronic
962434429 3:135351570-135351592 AAGAATTCTCTTGAGGAGGCAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963633998 3:147770485-147770507 AATAATTAGATGTAGGAGGAGGG - Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964640801 3:158908190-158908212 AAGATATAGATTGAGGAGGATGG + Intergenic
965306840 3:167075624-167075646 AAGAAAGAGATAAAGGAGGAAGG + Intergenic
966555876 3:181259673-181259695 AAGACTTTCATTGTGGAGGAGGG + Intergenic
967018414 3:185501699-185501721 AAGGAATAGAGTGAGGAGAAAGG + Intergenic
967374618 3:188786797-188786819 AAGAATTATACTGAGTGGGAAGG + Intronic
967610609 3:191501526-191501548 GATAATTAGATTTAGGAGGTTGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968604759 4:1529405-1529427 ACGATGTAGATAGAGGAGGAGGG - Intergenic
969841109 4:9882727-9882749 AAGGATTAGTTTGGGAAGGAAGG + Intronic
970628398 4:17915109-17915131 GAGAAGGAGATAGAGGAGGAGGG - Intronic
971756745 4:30717560-30717582 AGGAATGAGAGTGAGGAGGGCGG + Intergenic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
974928852 4:68337299-68337321 AACACTGAGAATGAGGAGGAAGG - Exonic
975639757 4:76488580-76488602 AAGAATTAAATGGAGGATGCTGG - Intronic
976197833 4:82550478-82550500 AAAAAATAGATTGAGGAGTAGGG + Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976676018 4:87704407-87704429 GAGAACTAGATTGAGGCTGATGG - Intergenic
976744730 4:88391791-88391813 AGGAATTGAATAGAGGAGGATGG - Intronic
976956117 4:90902651-90902673 AAGGCTTAGGGTGAGGAGGAAGG + Intronic
978047778 4:104153381-104153403 GAGAATTAGATTCAGAAGCAAGG - Intergenic
978883632 4:113739946-113739968 AAGAAATGGAGTGAAGAGGATGG - Intronic
979005557 4:115290682-115290704 AAGAATTAGACTTAGGAGACTGG + Intergenic
979276964 4:118824826-118824848 GAGAACTAGGTGGAGGAGGAGGG + Intronic
979716648 4:123847236-123847258 AAGAATGACATTGAGGATAATGG + Intergenic
980343969 4:131587754-131587776 AAGAAGGAGATTGGGAAGGAAGG - Intergenic
982546729 4:156742674-156742696 AAGAAATCCATTAAGGAGGAAGG - Intergenic
984274584 4:177594644-177594666 AAGTATTAGAGAGAGGAGGTTGG + Intergenic
985787307 5:1903938-1903960 AAGGATAAGATTGAGCAAGAGGG + Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986253726 5:6084081-6084103 AAGAAGTAGAAAGAGAAGGACGG + Intergenic
987055704 5:14189429-14189451 TAGAATTGGATTGAGGAGGGCGG + Intronic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987562659 5:19543672-19543694 CAGAATTACAGTAAGGAGGAAGG + Intronic
987811487 5:22841732-22841754 AAGAACTGTGTTGAGGAGGAGGG + Intronic
988015749 5:25556676-25556698 AGGAATTATATAGAGGAGGCTGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988453100 5:31362867-31362889 AGGAAGTGGAGTGAGGAGGAAGG - Intergenic
989978355 5:50612121-50612143 AAGAAAAACATTGAGGAGAAAGG + Intergenic
990124484 5:52497407-52497429 AAGACTTAGATTGAGAAGAGAGG - Intergenic
990125020 5:52505005-52505027 AACAATTAAATTGCGGGGGATGG + Intergenic
990189826 5:53247241-53247263 AGGAATTAGATCAAGGAAGAAGG - Intergenic
990408410 5:55515486-55515508 AAAAGTTGGATTGAGGAAGAAGG - Intronic
990732961 5:58829430-58829452 AAGAAATTTATAGAGGAGGATGG + Intronic
991055861 5:62319360-62319382 AAGAATAAGACTGAAGAGGCAGG - Intronic
991397176 5:66216570-66216592 AAAAATTAGATTGTGGAAAAAGG - Intergenic
991397875 5:66223339-66223361 AATAATTAGATTGTGGGGGTTGG - Intergenic
991424459 5:66476378-66476400 AAAAATTAGATTTATGAGAAAGG - Intergenic
991476786 5:67029727-67029749 AAGAATGAAAGTGAGGTGGATGG + Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993407952 5:87535508-87535530 AAGAAAGAGAAAGAGGAGGAAGG - Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
994342771 5:98651488-98651510 AAAAATTGGATTGCGGAGCAAGG + Intergenic
994709947 5:103255094-103255116 AAGAATTAGACTGAGAGGGAGGG + Intergenic
995651286 5:114371160-114371182 AAGACTCAAATTGAGGAGCAGGG + Intronic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998497908 5:142606782-142606804 AAGAAATAGAGTTAGGATGAAGG - Intronic
998687343 5:144543595-144543617 AAGAATTTGCTTCAGGAAGAGGG + Intergenic
998719332 5:144926826-144926848 AATTATTAGTTTGAGGAGGAGGG - Intergenic
999839870 5:155413372-155413394 AAGTATGAGTTTGAGGAGAAGGG + Intergenic
999856575 5:155601102-155601124 GAAGATTAGATTGAGGAGCAGGG - Intergenic
1000138139 5:158373791-158373813 AGGAACTAGTTTGGGGAGGAAGG + Intergenic
1000483403 5:161807886-161807908 AAGAATTAGATTGCATAGCATGG + Intergenic
1001653566 5:173331404-173331426 ATGCGTTAAATTGAGGAGGAGGG - Intergenic
1002332287 5:178452210-178452232 AAGAATTTAATTTATGAGGAAGG + Intronic
1002383551 5:178848738-178848760 AAGACTCAGATTGATGCGGATGG - Intergenic
1003033335 6:2621546-2621568 GAGAATGAGAGTGAGGTGGAAGG - Intergenic
1003099232 6:3164409-3164431 AAGAAGGAGATTAAGGAAGATGG + Intergenic
1003658633 6:8039283-8039305 AGGAAGTATAGTGAGGAGGAGGG + Intronic
1003712232 6:8605077-8605099 AAGAATGAGAGGGAGGAGAAAGG - Intergenic
1004336935 6:14772285-14772307 AAAAATTAGAATGGGGAAGAGGG - Intergenic
1004636145 6:17469749-17469771 AAAAATTAGATGGAGAAGGAAGG + Intronic
1005047808 6:21658733-21658755 AAGAATTAGAAATAGGAGAAAGG + Intergenic
1005216256 6:23531977-23531999 TAAAATTCCATTGAGGAGGAGGG - Intergenic
1005416280 6:25603725-25603747 AAGAATTATATTGACAAAGATGG - Intronic
1005719245 6:28584733-28584755 AGAAATTAGATTGATAAGGAAGG - Intronic
1007043522 6:38748314-38748336 ATGAATGACATTGAGGAGGGAGG + Intronic
1007337966 6:41168424-41168446 GAGAAATAGATTAAGGAGGAGGG - Intergenic
1007364030 6:41377714-41377736 ATGAATGAGATTGAGGACTAGGG - Intergenic
1009424199 6:63496532-63496554 AAGAAATAGATTCAGGAAGTGGG + Intergenic
1009647943 6:66432224-66432246 AAGAATGAAAGTGAGGAGCAAGG - Intergenic
1009714029 6:67364008-67364030 AAAAATGAGTTTGAGGAGGTCGG - Intergenic
1009794390 6:68449183-68449205 AAGAGTTAAATGGGGGAGGACGG - Intergenic
1010194064 6:73223069-73223091 ATGAATTAAATTGACTAGGAAGG - Intronic
1010464565 6:76151718-76151740 AAGAGTGAGATTGAGAAGAAAGG - Intergenic
1010609942 6:77942260-77942282 AAGGATTACAAAGAGGAGGAAGG - Intergenic
1010995229 6:82524405-82524427 AAGAAATAGATCAAGGAAGATGG + Intergenic
1013164514 6:107577766-107577788 AAGAATTAGATTAAAGAAGTTGG + Intronic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1015875316 6:137816681-137816703 AAGAAATTTATTGGGGAGGATGG + Intergenic
1015889274 6:137953292-137953314 AAGAAGTATATTCAGGAGAAGGG - Intergenic
1017675534 6:156809989-156810011 AGGAATCAGATTCAGGAGGGAGG + Intronic
1018727897 6:166627512-166627534 AAGGAGTAGAAAGAGGAGGAGGG - Intronic
1019860237 7:3651994-3652016 ATGAATGAGTTTGAGGAAGAAGG + Intronic
1020473871 7:8571499-8571521 AAGAAATGGATTGAGGAAAAAGG + Intronic
1020587290 7:10085090-10085112 AAGAATTTGACTGAGGAGCATGG + Intergenic
1020647309 7:10830462-10830484 AAGAATTATATTTACGATGACGG + Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021095870 7:16535389-16535411 ATGAATGAGATAGAAGAGGAGGG + Intronic
1021584435 7:22193021-22193043 AAGAAATACAAGGAGGAGGAGGG - Intronic
1022734056 7:33059871-33059893 AAGAAATAAATTTAGGAGGTTGG - Intronic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1023386591 7:39664031-39664053 AAGAAAAACATTGAGGAGAAAGG + Intronic
1024429993 7:49276948-49276970 AAAAATTAAACTGAGGAGGCAGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1026061439 7:67030262-67030284 AAGTAATAGATTCAGGATGAAGG - Intronic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027163457 7:75818624-75818646 AAAAATTAGAAAGAGGAAGAGGG + Intronic
1027295218 7:76763112-76763134 AAGATTTACTTTGAGAAGGAGGG + Intergenic
1027518569 7:79173719-79173741 AAAATTTAGAGTGATGAGGAAGG + Intronic
1028096928 7:86772445-86772467 AAGAATGGGAGTGAGGACGATGG - Intronic
1028727820 7:94109249-94109271 AAGAAGGAGGTGGAGGAGGAGGG + Intergenic
1029046023 7:97629808-97629830 AAGAATTTGATTAAGAAGAAAGG + Intergenic
1029307100 7:99628467-99628489 AAGGATCAGAGTGAGGATGAAGG + Intronic
1030512232 7:110496956-110496978 AAAAAAAAAATTGAGGAGGAGGG - Intergenic
1030673146 7:112359203-112359225 TAGAATTAGATTTGGGAGGAAGG - Intergenic
1031007476 7:116489788-116489810 AATAATTAGACTGAAGAGGCAGG + Intronic
1031808464 7:126336370-126336392 AACAATTAGATAGAGGCGGGTGG - Intergenic
1032354455 7:131197042-131197064 GAGAATTAAACAGAGGAGGATGG - Intronic
1032952941 7:136937295-136937317 AATAATTAGAGTGAGGAAAAAGG - Intronic
1033432832 7:141304712-141304734 AAGTGCTAGAGTGAGGAGGAAGG - Intronic
1033850803 7:145492304-145492326 AAGAAATAGATAGAGGAGTGAGG - Intergenic
1033931135 7:146523520-146523542 AAAAAATAGATTAAGGAGGTTGG - Intronic
1034446708 7:151117382-151117404 AAGAAGGAGATTGTGGTGGATGG + Exonic
1035935060 8:3827718-3827740 AAGAAGTACAATGAGGTGGATGG - Intronic
1037480319 8:19299061-19299083 AAGAATTAGGTAGGGGAGGAAGG + Intergenic
1037829346 8:22178787-22178809 AGGAAGGAGTTTGAGGAGGAGGG - Intronic
1038787712 8:30635683-30635705 AAGAATGAGATAAAGGAGAAAGG - Intronic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1040399682 8:47036299-47036321 AAGAATGAGAGTGAGGTGGGAGG + Intergenic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042414148 8:68499999-68500021 GAGAAAGAGAGTGAGGAGGATGG - Intronic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1043354714 8:79399466-79399488 AAAATTTAGATTGAAAAGGATGG + Intergenic
1045531052 8:102985770-102985792 AAGAAGTAGATTGGGGACCAGGG + Intergenic
1045608443 8:103806124-103806146 AAGAATTAGAGTCATGAGGGTGG + Intronic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1047370243 8:124250217-124250239 ATGAATTAGATGGTGGATGAAGG - Intergenic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1048508890 8:135044602-135044624 AAAAATTAGATTGAGAGTGAAGG - Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048896090 8:138993708-138993730 AAGAATGAGATAGTGCAGGAAGG + Intergenic
1050248737 9:3720561-3720583 AAGAGTGAGATTGAGGAAAATGG - Intergenic
1050473247 9:6015210-6015232 AGGAATTTGATAGATGAGGATGG - Exonic
1050479576 9:6075744-6075766 AAAAAATAGATTGAGGAGGCCGG - Intergenic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1051151173 9:14080716-14080738 AAGATTTAGGCTGAGGCGGATGG - Intergenic
1051256145 9:15215944-15215966 AAGAATGAAATTGAAGAGGTTGG - Intronic
1052683386 9:31723405-31723427 GAGAATCAGAGTGAGGGGGAAGG - Intergenic
1055426865 9:76205494-76205516 ATGAGTTAGATTCTGGAGGAGGG - Intronic
1055868232 9:80841611-80841633 TAGGAGTAGAGTGAGGAGGAGGG - Intergenic
1056688118 9:88783536-88783558 AAGAAGAAAATGGAGGAGGAGGG + Intergenic
1057936602 9:99244887-99244909 AGGAAATAGAGTGAGGAGAAGGG + Intergenic
1058383305 9:104403904-104403926 AAGAGGAAGATTGAGGAGAATGG - Intergenic
1058383455 9:104405826-104405848 AAGAGGAAGATTGAGGAGAATGG - Intergenic
1059217453 9:112578698-112578720 AAGATTTGGATTGAGCAGTATGG - Intronic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203756359 Un_GL000218v1:130999-131021 ACAAATTTGATTGAGGAAGAAGG - Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186999377 X:15159317-15159339 AAGAAGTACATAGGGGAGGAGGG + Intergenic
1188002945 X:24999102-24999124 AAGAAGTATATTGAGGAGCATGG - Intergenic
1188482161 X:30647248-30647270 AAGAATTAGATTGTGAGGAATGG + Intergenic
1188723236 X:33548807-33548829 AAAAAAAAAATTGAGGAGGAGGG - Intergenic
1189743735 X:44148326-44148348 AAGAATTATTTTGATGAGGTGGG + Intronic
1190332462 X:49244271-49244293 AAGAAGTAGACAGAGGAGAAGGG - Intronic
1191053099 X:56215293-56215315 AAGAATTAGATGGAGGATTCAGG + Intergenic
1192318320 X:70068245-70068267 AGGAAATAGACTGAGGAGCAAGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193129842 X:77908224-77908246 AAGAATGAGATTTATGAGGTTGG - Intergenic
1194148157 X:90288816-90288838 AAAAAGCAGCTTGAGGAGGAGGG + Intergenic
1194407901 X:93520515-93520537 AATAAATATATTGAGGATGATGG + Intergenic
1194520329 X:94910085-94910107 AAAAAAAAAATTGAGGAGGAGGG + Intergenic
1194547721 X:95258363-95258385 AAGACTCAGAATGGGGAGGATGG - Intergenic
1195586473 X:106570652-106570674 ATGAAAGAAATTGAGGAGGAGGG + Intergenic
1196932800 X:120697673-120697695 ACTATTTAGATTCAGGAGGATGG + Intergenic
1197119069 X:122868896-122868918 AAGTACTGGTTTGAGGAGGAAGG - Intergenic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198523305 X:137474240-137474262 AAGAAGTAGGTTGAGGAGGTAGG + Intergenic
1198597628 X:138254091-138254113 AAGAAGTTGATTAAGGAGAAAGG - Intergenic
1198697483 X:139357758-139357780 AAGAAGTTGATTAAGGAGAAAGG + Intergenic
1198809770 X:140523706-140523728 ATGAATTAAATTGAAAAGGAAGG - Intergenic
1199150465 X:144478962-144478984 AAGAATTAGCTAATGGAGGACGG + Intergenic
1199178624 X:144824570-144824592 AATAATTAGAAAGAGGAGAACGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200494541 Y:3865587-3865609 AAAAAGCAGCTTGAGGAGGAGGG + Intergenic
1201539659 Y:15092070-15092092 AAGAATTATTTTGAAGAGGTGGG + Intergenic