ID: 1148515566

View in Genome Browser
Species Human (GRCh38)
Location 17:48213726-48213748
Sequence GGCAAATATCATTCCTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148515566_1148515568 25 Left 1148515566 17:48213726-48213748 CCATAACAGGAATGATATTTGCC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1148515568 17:48213774-48213796 AATGTTATTTCTCACCACAGAGG 0: 1
1: 0
2: 4
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148515566 Original CRISPR GGCAAATATCATTCCTGTTA TGG (reversed) Intronic
906079624 1:43076213-43076235 GGCCAATTTCATTCTTTTTATGG + Intergenic
906690047 1:47786527-47786549 GGCAACTGGCATTCCTGTGAAGG - Intronic
907758312 1:57332783-57332805 GGCCAATTTCATTCATTTTATGG + Intronic
911865655 1:103018244-103018266 GGCAATTATGTTTCCTTTTATGG + Intronic
913118159 1:115715382-115715404 TGCACATATCATTCCTTTTAAGG - Intronic
919353400 1:196489303-196489325 GGCAAAGATCCTTGCTGTCATGG + Intronic
1063275784 10:4566177-4566199 TGCAAATGAAATTCCTGTTAAGG + Intergenic
1063860178 10:10298501-10298523 GTCAAATATGTTTCCTGTTGTGG + Intergenic
1063938306 10:11101883-11101905 GGAAAATATCATTATTGTTGAGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067774845 10:49155693-49155715 GGAAAATATCATGCCTCTTCTGG - Exonic
1069568335 10:69478564-69478586 AGCAAATATCATTCCTGCCATGG - Intronic
1075011612 10:118875156-118875178 GGTAAAAATAATTGCTGTTAAGG - Intergenic
1077920096 11:6635565-6635587 GGCACAGATCATTTCTGTCAAGG - Intronic
1079363137 11:19786577-19786599 GGCAAAAATCAGTACTCTTATGG - Intronic
1079494043 11:21020956-21020978 GGAAAAAATCCTTCCTGGTAAGG + Intronic
1080442964 11:32312326-32312348 TACAAATATTATTCATGTTAAGG + Intergenic
1089984417 11:122799639-122799661 GTCAAATAACTTTCCTGTTTTGG + Intronic
1092640556 12:10504069-10504091 TGCAAATAACATATCTGTTAAGG + Intergenic
1093140478 12:15504715-15504737 GGCACATATAACTCCTGATAGGG - Intronic
1093301788 12:17467731-17467753 GGCAAATTTCATGTCTGGTAAGG - Intergenic
1093418335 12:18946551-18946573 TGCACAAATCTTTCCTGTTATGG - Intergenic
1093584981 12:20823929-20823951 GGAAAATGTCATTCCAGTCAAGG + Intronic
1099351744 12:81579438-81579460 GACGAATATCATTCCTGACATGG + Intronic
1099586001 12:84514738-84514760 GGCAAAGATCATTAATATTATGG - Intergenic
1106751831 13:32780438-32780460 GTCAAATAGCATTCCTGCTGGGG - Intergenic
1108988069 13:56619410-56619432 GGGAAAAATCATTCCTATTCTGG - Intergenic
1109976882 13:69848785-69848807 GCCAATTATTATTCATGTTAAGG - Intronic
1110457199 13:75702587-75702609 AGCAAATAACATTCCTTTAAGGG - Intronic
1112577862 13:100653026-100653048 TGCAAAAATAATTCCGGTTAAGG - Intronic
1114711420 14:24782007-24782029 GGTAGATAACATTTCTGTTATGG - Intergenic
1115081674 14:29460564-29460586 GGCCAATATCATTGCTATTGAGG - Intergenic
1117323158 14:54643442-54643464 GGCAAATGTCAGTCCTTTTATGG + Intronic
1118794525 14:69129222-69129244 GGCAAAAATCATCGCTGTGATGG + Intronic
1120913114 14:89685881-89685903 GGCAGAGAGCATTCCTGTTTGGG + Intergenic
1129517756 15:76167003-76167025 TGCAAATATAATTTCTGCTATGG - Intronic
1130109586 15:80953652-80953674 GGCAAAGAACATTCCTGGTGAGG + Intronic
1130761578 15:86826240-86826262 GGCAAATATCATTGATGTTCTGG + Intronic
1135644987 16:24154052-24154074 GGCAAGTATCTTTGCTGTTTTGG - Intronic
1137678731 16:50319725-50319747 GGCAAATACCTTTTATGTTAGGG + Intronic
1138369070 16:56510041-56510063 GGGAAATATCATACATGTTCAGG + Intronic
1141583926 16:85020367-85020389 GGCAAAGCTCCTGCCTGTTATGG + Intergenic
1143295158 17:5865632-5865654 TGCACATATTATTCTTGTTATGG - Intronic
1143909270 17:10234501-10234523 GGCACAAATCAGTCCTGATATGG - Intergenic
1145727537 17:27145485-27145507 GGCCTAGATCATACCTGTTATGG - Intergenic
1147849470 17:43430696-43430718 GGGAAATATAATCCCTGTTGTGG + Intergenic
1148515566 17:48213726-48213748 GGCAAATATCATTCCTGTTATGG - Intronic
1149801779 17:59575642-59575664 GGCAAAAATCACTACTGTCAAGG - Intronic
1149844710 17:59999838-59999860 GGCAAAAATCACTACTGTCAAGG + Intergenic
1150997046 17:70330637-70330659 GGCAAATATCATTGCATTTTAGG - Intergenic
1153073030 18:1128287-1128309 GCCAAATATCATTACTGATGAGG - Intergenic
1155191318 18:23433441-23433463 GGCAAAGTTCATTTCTGTTCTGG - Intronic
1155780270 18:29823284-29823306 GGCTAATAGCATTTCTGTGATGG + Intergenic
1158033754 18:52999666-52999688 GGTCAATATCATTTCTCTTACGG - Intronic
1158313209 18:56181569-56181591 GGCATGTACCATTACTGTTAGGG - Intergenic
1158386112 18:56993763-56993785 GGAAAATATCATTCCTGTGAAGG - Intronic
1160445160 18:78921921-78921943 GGCAACTATGATGTCTGTTAGGG - Intergenic
1162653661 19:12111788-12111810 GGGAAGTATCATGCCTGTAAGGG + Intronic
1166437610 19:42782041-42782063 TGCAAATCTCATTCCTGTGAAGG - Intronic
1166466519 19:43036708-43036730 GGCAAATCTGATTCCTGTGAAGG - Intronic
925511399 2:4629748-4629770 TGCAAATATCAATACTGTTATGG - Intergenic
926223122 2:10949108-10949130 GGCAACTTTCATTGCTGTTTGGG + Intergenic
927326652 2:21812887-21812909 GGGAAATATCATTGTTCTTAGGG + Intergenic
928410297 2:31049294-31049316 AGCAAAAATCATTCCTGCTTTGG - Intronic
929202937 2:39257155-39257177 CGCAAATATCTTTACTGATAAGG + Intronic
932850513 2:75180016-75180038 TGCCAATATCATTCCTGCTTTGG + Intronic
933293315 2:80461819-80461841 GGAAAATATCATTCTTCTGAGGG - Intronic
939630362 2:144521266-144521288 GGAAAATATCTTTCTTGTTTAGG - Intronic
939883121 2:147652254-147652276 GACAAATTCCATTCCTGTGATGG + Intergenic
939999714 2:148954903-148954925 GGCTTAAATCATTCCTGTTGGGG + Intronic
941673181 2:168316962-168316984 GACAAAAATCATTACTGCTATGG - Intergenic
943971974 2:194421823-194421845 GGCAAATACCATCCCTGTGAGGG + Intergenic
945606791 2:211943217-211943239 GGCCCATATAATTCCTTTTAGGG + Intronic
945733147 2:213565914-213565936 GGAAAATACCAGTCCTGCTAAGG + Intronic
947910345 2:233796379-233796401 GGCAAGTTTCATTCATGTTCGGG + Intronic
948014764 2:234679120-234679142 AGCAAATACCATTGCTGCTATGG + Intergenic
1168738782 20:169493-169515 GGAAAATACCATGTCTGTTAAGG + Intergenic
1169175177 20:3505211-3505233 GGCAAATCTCATTTCTCTTCTGG + Intronic
1173342372 20:42163935-42163957 AGCGAATATCACTCCTGTGATGG + Intronic
1179383841 21:40923867-40923889 AGTAAATATGTTTCCTGTTAGGG + Intergenic
1182569895 22:31229128-31229150 GCCAAATATCATTCCCGTGGAGG + Intronic
1182906459 22:33941710-33941732 GGAAAATATCATTCTTATTATGG + Intergenic
949300629 3:2579816-2579838 GGTAAACATAGTTCCTGTTATGG + Intronic
951511682 3:23509515-23509537 GCCAAATATCAATCCCTTTATGG + Intronic
952471891 3:33663497-33663519 GGCAAATATCATTTCTAATCTGG + Intronic
957135693 3:76286215-76286237 GACAAATATCATTGCTTTTATGG - Intronic
958045101 3:88274684-88274706 GGCAAATAGCTTTACTTTTATGG + Intergenic
960476194 3:118131721-118131743 GGCATATTTCATTCCTCTTATGG + Intergenic
965496913 3:169410224-169410246 TGCAAATATAATTCAAGTTAAGG - Intronic
965553446 3:169994974-169994996 GGGAAATATCATTCTTACTATGG + Exonic
965775652 3:172227725-172227747 GGTAAATATTTTTCCTTTTATGG - Intronic
970863153 4:20727216-20727238 TGCAAATATAATACCTATTAGGG + Intronic
973208263 4:47584996-47585018 GGCACATATCATGCTTTTTAGGG - Intronic
974457231 4:62143998-62144020 GGCAACTAACTTTCCTGCTAAGG - Intergenic
975823928 4:78300153-78300175 GGCAGATTTCATGCATGTTAAGG + Intronic
976051361 4:81014837-81014859 GTCAAATATGATTCCTTGTATGG - Intergenic
977797621 4:101186103-101186125 GGCAAATATCATTTCAGTTGGGG - Intronic
981086628 4:140690104-140690126 GGCATATACCATTTCTGCTATGG - Intronic
981164289 4:141539213-141539235 GCCAAATATCATTCTTTTTTAGG - Intergenic
981769017 4:148285182-148285204 GGTAAATAACTTTCCTCTTATGG - Intronic
981904543 4:149906090-149906112 GGCAAATATAAATACTGCTATGG - Intergenic
982580471 4:157172404-157172426 GGCAAGTTTCATTCATATTAGGG + Intergenic
982646118 4:158026888-158026910 GGCCAATATCTTTGCTGTTTGGG + Intergenic
982668005 4:158290690-158290712 GGTAACCATGATTCCTGTTAAGG + Intergenic
983372657 4:166881302-166881324 GGAATAAATCATTTCTGTTATGG - Intronic
983632295 4:169861363-169861385 GGCACTTATCCTTCCTGTAAAGG - Intergenic
985077581 4:186231783-186231805 AGCAAATATTATTCTTTTTAAGG + Intronic
991514435 5:67418390-67418412 GGAAAATATCCTTTCTGTTGAGG - Intergenic
991986854 5:72297306-72297328 GGTAAATATCATTACTTTGAAGG + Intronic
993506287 5:88712996-88713018 GACAAATATCATTACTGGTTGGG + Intergenic
995239771 5:109872772-109872794 CGCCAAGATCATTCCTCTTAAGG + Intergenic
995485769 5:112638550-112638572 GGCAAAAATCATGCCCATTATGG + Intergenic
995612741 5:113927340-113927362 AGCAAATAGCATTCCTTTTTTGG + Intergenic
996338298 5:122408569-122408591 TTAAAATATTATTCCTGTTAGGG - Intronic
998842640 5:146272094-146272116 GGCAAATGTCTTTACTGTTTTGG + Intronic
999959860 5:156743019-156743041 GGCAAAAAATATTCCTGTGATGG - Intronic
1000489553 5:161893729-161893751 GGCAAATTTACTTCCTCTTATGG + Intronic
1000620583 5:163481326-163481348 TGCTAATATCAATCCTGTAAAGG + Intronic
1004032578 6:11885203-11885225 GGCACATATCCTTCCTGATGAGG + Intergenic
1004757281 6:18625470-18625492 GGCAGATATCCTTCCTCTTTTGG + Intergenic
1005121567 6:22395463-22395485 GGCAAAAATCATACTTGCTATGG - Intergenic
1008497878 6:52151604-52151626 GGAAAAGATCCCTCCTGTTAAGG - Intergenic
1008831151 6:55764273-55764295 GGCCAATTTCATTCTTTTTATGG - Intronic
1008863370 6:56178702-56178724 GGTAAATATTAATCCTATTAGGG - Intronic
1009390791 6:63140792-63140814 GGCAAATATCTTTCCATTCAAGG - Intergenic
1014217098 6:118762745-118762767 GGCCAATTTCATTCTTTTTATGG + Intergenic
1015339701 6:132084367-132084389 AGCAAATATCATCCATGTGAAGG - Intergenic
1016623212 6:146136104-146136126 AGAATATATCATTCTTGTTATGG + Intronic
1019784146 7:2963393-2963415 GGTAAATATTGTTCATGTTAAGG - Intronic
1033886228 7:145949806-145949828 GGCAAATAACATTTCTGGAAAGG + Intergenic
1036983306 8:13495987-13496009 GGCTAATATCATTTTAGTTATGG - Intronic
1039065825 8:33606642-33606664 AGAATATATCATTCCTGTTTTGG + Intergenic
1039531193 8:38264567-38264589 GGCAAATGTCATTCCAATCATGG + Exonic
1040697705 8:50022191-50022213 GGGAAATAACATCCCTGTGATGG + Intronic
1043375716 8:79647335-79647357 GTGAAATATGATTTCTGTTAGGG + Intronic
1044311862 8:90702696-90702718 GGCAAAAATCTTACCTGTCAAGG + Intronic
1044671654 8:94687260-94687282 GACATATATCATCCCTTTTATGG + Intronic
1046491579 8:114959649-114959671 TTCATATCTCATTCCTGTTAGGG - Intergenic
1047947493 8:129896440-129896462 GGAAAATATCATTGCTGTCCAGG - Intronic
1051586270 9:18730419-18730441 TGAAAATATTATTCCTGTCATGG + Intronic
1055534484 9:77224339-77224361 GGCAGCTATCATTCCTCTGATGG + Intronic
1057407377 9:94785323-94785345 GGAAAATTTCAGTCCTGTTGTGG + Intronic
1058361722 9:104155320-104155342 GCCAAATTTTATTCCTGTTTTGG - Intergenic
1186592762 X:10948793-10948815 GGCAAAAATCAGTCCTTTAAGGG + Intergenic
1186879110 X:13846863-13846885 GGCAAACATCATTACTGTCATGG + Intronic
1188305882 X:28559320-28559342 CGCAAAGATCATTCTTGCTATGG - Intergenic
1188421851 X:29999774-29999796 GGCAAATATTTTTTCTGTAAAGG + Intergenic
1188731357 X:33649790-33649812 GGCAAATATGATTTTTATTATGG - Intergenic
1188801666 X:34539072-34539094 CGCAAATCTCATTCTTTTTATGG - Intergenic
1188944134 X:36277370-36277392 GGCACAGATCATGCCTGCTATGG - Intronic
1191194192 X:57703941-57703963 GGCAAATATTATTGCTGTGCTGG - Intergenic
1191207335 X:57849022-57849044 GGCAAATCTCAGTCCTGTGCTGG - Intergenic
1194003877 X:88466420-88466442 AGCAAAGATCATTCTTTTTAGGG - Intergenic
1196805131 X:119576748-119576770 GGTAAATATCATTACTCTTCAGG + Intronic
1198602874 X:138303246-138303268 TGCAAATATCTTTCATTTTATGG + Intergenic