ID: 1148516857

View in Genome Browser
Species Human (GRCh38)
Location 17:48227163-48227185
Sequence CTGTGAATGGAGAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148516853_1148516857 15 Left 1148516853 17:48227125-48227147 CCAGGACTGGCATGATATCTCAA 0: 1
1: 0
2: 2
3: 7
4: 121
Right 1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG 0: 1
1: 0
2: 1
3: 34
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148516857 Original CRISPR CTGTGAATGGAGAGGGAACA TGG Intronic
900175141 1:1288183-1288205 CAGGGAATGGAGCGGGGACACGG - Intronic
900485622 1:2921284-2921306 CTGTGAAGGGAGAGGGGATGCGG - Intergenic
901146696 1:7069690-7069712 CTGAGAGTGGAGTGGGAACAGGG + Intronic
901152559 1:7113487-7113509 CTAGGAATGGAGAGGGAGGAAGG + Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901865711 1:12105370-12105392 CTGTGAAGGATGAGGGAACGAGG - Intronic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
902973403 1:20071538-20071560 CTGTGAAGAGAGAGAGCACACGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903837548 1:26215340-26215362 CTGGGAATGTAGTGGGAACCAGG + Intergenic
903976059 1:27150996-27151018 CTGAGAGTGCAGAGGGAGCATGG + Intronic
904289390 1:29474471-29474493 CAGTGAATGGGGAAGGCACACGG - Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
906093150 1:43199929-43199951 CTGAGATTGGAGAGGTCACAAGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907966901 1:59340470-59340492 CTTTGAAAGGAAATGGAACATGG + Intronic
908119917 1:60976335-60976357 TTGTGAATGGAGAGAGAAAGCGG - Intronic
908344953 1:63222615-63222637 TTATGAATAGAGAGGGAAAAGGG - Intergenic
908450018 1:64244769-64244791 CTGTTCATGAAGAGGGACCAGGG + Intronic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
909111874 1:71489356-71489378 CTAAGAATGGGCAGGGAACAAGG - Intronic
912460784 1:109829584-109829606 CTGTGATTGCACAGGGACCATGG + Intergenic
912711145 1:111950736-111950758 CTTTGAAGGGAGAGGTGACAAGG + Intronic
915229469 1:154434872-154434894 CTGTGCATGGGGAGTGAACGGGG + Intronic
915329925 1:155104716-155104738 ATGTGAATGGAGAGCCACCAAGG - Intergenic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917680977 1:177367004-177367026 CTATGGATGGAGGGGGATCAAGG + Intergenic
919453505 1:197798660-197798682 CAGAGAATTGAGAGGGAACATGG - Intergenic
919484578 1:198130950-198130972 GTGAGAATGGAGAGAGAAAATGG - Intergenic
919754132 1:201056194-201056216 CTGTGCATGGAGGGTGAACAGGG + Intronic
920164572 1:204026481-204026503 ATGTGAATGGCCAGGGAAGAGGG + Intergenic
921541884 1:216426122-216426144 CTATTAATGGAGAAGAAACAAGG + Intergenic
922868913 1:228884229-228884251 CTTTCAGTGGAGAGGGGACATGG - Intergenic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
923127516 1:231045397-231045419 CTTTGAATTGAGAGGCAACCTGG + Intergenic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924474459 1:244371109-244371131 CTGTAAATGGAGTGGGATCTGGG - Intronic
924700301 1:246444564-246444586 TTGTGAATGGAGAGGTAGGAAGG + Intronic
924709207 1:246519851-246519873 GTGGGAATGGAGAGGGGACTAGG - Intergenic
1063497015 10:6519562-6519584 CTCTGATTGGACAGGGAACCAGG + Intronic
1063879225 10:10513823-10513845 CTTTGCATAGAGAGGGAACCAGG - Intergenic
1064243511 10:13651405-13651427 CTTTGAATGTAGATAGAACATGG + Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065038369 10:21663876-21663898 CAGTGAATTGAGAGGTCACAGGG - Intronic
1067769277 10:49111662-49111684 CTGTGAGTGGAGAGGTACAACGG - Intronic
1068802029 10:61152257-61152279 CTGTGAATGGACAGGAACCAGGG - Intergenic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069604833 10:69732526-69732548 ATGTGGATGGAGAGAGAACCAGG + Intergenic
1069781610 10:70959701-70959723 ATGAGAAGGTAGAGGGAACAGGG - Intergenic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1072720710 10:97779343-97779365 CTGAGACTGCAGAGGGAGCAGGG - Intergenic
1074006288 10:109427781-109427803 ATTTGGGTGGAGAGGGAACAGGG + Intergenic
1074555889 10:114489611-114489633 CTCTGAATGCAGAGGGCCCAGGG + Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1076059379 10:127401573-127401595 ATGTGAATTGAGAGGCAAAATGG - Intronic
1076476418 10:130756831-130756853 CCCTGAATGGAGAGTCAACAGGG - Intergenic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1077164779 11:1130123-1130145 TTGTGAATGAACAAGGAACAAGG - Intergenic
1077395673 11:2319934-2319956 CTGTGGAGGGACAGGGTACATGG + Intergenic
1077872009 11:6270493-6270515 CTGGGAAGGGAGAGAGAACTGGG - Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078630361 11:12997618-12997640 ATGCGAAAGGAGAGGGAAAAAGG + Intergenic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1080302710 11:30801958-30801980 CTGGGAGTTGTGAGGGAACAAGG - Intergenic
1081413437 11:42786054-42786076 CTGTCAGTGGGGAGGAAACAGGG + Intergenic
1083272693 11:61580305-61580327 CTGTGAATTGAGAGGGTGCCAGG - Intronic
1084711683 11:70847657-70847679 GAGTGAATTGAGAGGGAGCATGG - Intronic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085183969 11:74559759-74559781 AGGTGAATGGAGAGGGGTCATGG - Intronic
1086558210 11:88136850-88136872 CTAAGAATGGAGAAGGGACAGGG - Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087289598 11:96305435-96305457 CTATGCATGGATAGGGAACTGGG + Intronic
1087419175 11:97898683-97898705 CTGGGAAAGAAGAGGTAACAGGG + Intergenic
1088482941 11:110312957-110312979 CTTTAAATGGAGAGGAAAAATGG + Intergenic
1089275901 11:117336038-117336060 CCCTGAATGGATAGGGAAAATGG - Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089989544 11:122846133-122846155 CTGTGAATGGAGTGGGTACCCGG - Intronic
1090043478 11:123310903-123310925 CTACAAATGGAGAGGCAACATGG - Intergenic
1091228154 11:133970547-133970569 CTGTGAGTGAAGAGTGAAGATGG - Intergenic
1091933424 12:4415561-4415583 AAGTGATTGGAGAGAGAACAAGG - Intergenic
1093690119 12:22101213-22101235 CAGAGCATTGAGAGGGAACATGG - Intronic
1095324964 12:40878323-40878345 CTGTGAATGATCAGAGAACAGGG - Intronic
1096094015 12:48922758-48922780 CTGGGAATGGGGAGGTAATAGGG + Intronic
1096488834 12:52002542-52002564 ATGTGAATGGTGAGGGAAAGAGG + Intergenic
1096582918 12:52600038-52600060 CAGTGAGTGGAGAGGAGACAGGG - Intronic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097250005 12:57627305-57627327 CTGGGAATGGAGATTCAACATGG + Intronic
1097902254 12:64884742-64884764 CTTTGAGTGGATAGGGGACAAGG - Intergenic
1098232196 12:68383248-68383270 CTGTCAATGGAGAGGTGGCATGG - Intergenic
1099019870 12:77390273-77390295 CTGTGTATGGAGAGGAGCCAGGG - Intergenic
1099894277 12:88625406-88625428 CTGGGAATGGAAAGTGAACTTGG + Intergenic
1101869562 12:108553728-108553750 CTTTAAATGGAGTGGGGACAAGG + Intronic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103852299 12:123941061-123941083 CCGTGACTGGAGAGGCCACAGGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104225064 12:126823530-126823552 CGGAGAGAGGAGAGGGAACAAGG - Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104387139 12:128360776-128360798 GTGTGGATGGACAGGGATCAAGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105415151 13:20205547-20205569 CTGTTCATGGGGAGGGAACAGGG - Intergenic
1105628895 13:22141477-22141499 CTGACAATGGAGATGGGACACGG - Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106616279 13:31331561-31331583 CTGGGAATGGGGAGGGGAAATGG + Exonic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1107128248 13:36867902-36867924 CTGTGACTGGACAGTGATCATGG + Intronic
1107264958 13:38542591-38542613 GTGTGAATATAGAGGGAAAATGG - Intergenic
1109962185 13:69645198-69645220 CTCTGGATGGATAGGGAACATGG + Intergenic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1111338150 13:86848158-86848180 CAGTGCATTGAGAGGGAGCATGG + Intergenic
1113488876 13:110676696-110676718 CAGAGAAGGGTGAGGGAACAGGG + Intronic
1113748187 13:112760621-112760643 CTGAGCAAGAAGAGGGAACAGGG - Intronic
1113954599 13:114090738-114090760 CTGTGAATTTAGAGGAAGCAAGG - Intronic
1114278799 14:21170733-21170755 CAGAGCATTGAGAGGGAACATGG + Intergenic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114629250 14:24148556-24148578 CTGTGAATGTTAAGGGACCAGGG + Intronic
1117067020 14:52021354-52021376 ATGTGAATGGGTTGGGAACAGGG + Intronic
1117215900 14:53551341-53551363 CTGAGAATAGAGAGATAACAAGG - Intergenic
1117895663 14:60483923-60483945 CAGAGAATGGAGAGGAAACGAGG + Intronic
1118107446 14:62676120-62676142 GTGTGAACGGAGAGAGAACAAGG - Intergenic
1118483873 14:66195789-66195811 CTTTCCATGGAGAGGGGACATGG + Intergenic
1118511630 14:66480986-66481008 CTGTGATTGGAGAAGAAACCTGG + Intergenic
1119193117 14:72697758-72697780 TTGTGCATGGAGAGGAAAAATGG + Intronic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122881864 14:104693861-104693883 CTGTGCCTGGAGCAGGAACAGGG - Intronic
1125709014 15:41768630-41768652 CTGTCAATGAAGACAGAACAGGG - Exonic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128143989 15:65322191-65322213 CTTGGAACGGAGAGGGAGCAGGG - Intergenic
1128222545 15:65979420-65979442 CTGCGAATGCAGAGGTCACAGGG - Intronic
1128504617 15:68258785-68258807 TTGTGAATGGAGACGGGGCAAGG - Intergenic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1128930247 15:71697884-71697906 GTATGCATGGAAAGGGAACATGG + Intronic
1129518184 15:76169654-76169676 GTGGGAGTGGAGAGGGCACAGGG + Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1129975093 15:79815392-79815414 CAGTGATGGGAGAGAGAACAAGG + Intergenic
1131350711 15:91697379-91697401 CCCAGAATGGACAGGGAACAAGG + Intergenic
1131921157 15:97330150-97330172 CAGGGAATGGAGTGGGAAAACGG - Intergenic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1132468756 16:90088-90110 CTGGGAAGGGAGAGGGGCCAGGG + Intronic
1133221157 16:4319729-4319751 CAGGGACTGGAGAGGGATCATGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133361888 16:5180556-5180578 CTTTGAATAGAGTGGGAAGAAGG - Intergenic
1133690261 16:8207595-8207617 CTGTTAAGGGAGAGGGGAGAGGG - Intergenic
1135762368 16:25147540-25147562 CTGTGAATGGACAGAGAAATGGG - Intronic
1135949997 16:26905305-26905327 CTGTAACTGGAGAGGGAAAGTGG - Intergenic
1136072035 16:27793154-27793176 TTGAGGATGGAGAAGGAACAAGG - Intronic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1141862662 16:86728531-86728553 CAGTGTATGAAGAGCGAACAGGG + Intergenic
1142511124 17:394081-394103 CTGTTCATGGAGAGGGAGCGAGG - Intergenic
1143410081 17:6703382-6703404 CTGGGGATGGTAAGGGAACACGG + Intronic
1143565506 17:7717930-7717952 TTGTGGAGGGAGAGGGAGCAAGG + Exonic
1145788880 17:27611785-27611807 CCGGGAATGGGGAAGGAACAGGG + Intronic
1146243567 17:31255830-31255852 CTGGGAGTGGAGAAGGAACAAGG - Intronic
1146620040 17:34390144-34390166 CTGGGAATGGAGTAGGAACCAGG - Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148892663 17:50819403-50819425 CTGTTCATGGAGGGGGAATACGG + Intergenic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1156778143 18:40818844-40818866 CTGTGAAGGAAGTGGTAACAAGG + Intergenic
1158373031 18:56831254-56831276 ATGTGTATAGAGTGGGAACAGGG + Intronic
1159076264 18:63685108-63685130 CTTTCAGTGGAGAGGGAACATGG + Intronic
1159292359 18:66439611-66439633 CTGGGAATGGGGAGAGACCAGGG - Intergenic
1159609400 18:70509407-70509429 TTGGGAAGGGAGAGGCAACATGG + Intergenic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161799968 19:6412152-6412174 ACGTGAAGGGAGAGGGGACAGGG - Intergenic
1161874213 19:6895114-6895136 CTAAGATTGGAGAGGCAACAAGG - Intronic
1162082660 19:8227808-8227830 GTGCCAAAGGAGAGGGAACAGGG + Intronic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1163288356 19:16363457-16363479 CTGGGCATGGAGAGGGACCGAGG - Intronic
1164799088 19:31061091-31061113 CAGTGAATGGAGACAGAACTGGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1166100788 19:40570411-40570433 GTGTGAAGGGAGGGGGAAGAGGG - Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1167123336 19:47532071-47532093 CTGGAAATGGAGGGGGAAGAAGG + Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925153765 2:1634987-1635009 CTCTGACTGGAGATGGGACAGGG + Intronic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
926416636 2:12656178-12656200 CTGTGAAGGGAATGTGAACACGG + Intergenic
926725594 2:15995022-15995044 CTGTGAAAGGAGGGATAACAGGG - Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928950506 2:36809155-36809177 CTGAGTAGGGAGAAGGAACAAGG + Intronic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
929094929 2:38254426-38254448 CTTTCAATGGAGAGGGGACATGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931584827 2:63813788-63813810 CTGTGACTGGAGAGAGAATAAGG - Intronic
931758339 2:65394395-65394417 CTGTGAATGGACAGGAACAAGGG + Intronic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
933353989 2:81192587-81192609 CTGTGAATGGGTAGGGAATCTGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934771396 2:96909879-96909901 CTGTGAGTGGAGACAGAACTCGG + Intronic
935047224 2:99493222-99493244 CAGAGAAAGGAGAGAGAACAGGG + Intergenic
935069486 2:99681475-99681497 ATGTGAATTTTGAGGGAACACGG - Intronic
936678018 2:114738223-114738245 CTGAGATTTGAGTGGGAACATGG + Intronic
937371786 2:121303320-121303342 ATGTGACTGGAGAGGGGACCCGG + Intergenic
937397277 2:121547687-121547709 TTGAGAATTGAGAGGGAACACGG + Intronic
937718267 2:125060319-125060341 CTGTGCATGGGGAGGGTTCAGGG + Intergenic
938587450 2:132705375-132705397 GTCTGATTGGAGAGGGATCAAGG - Intronic
939627721 2:144498554-144498576 TGGTGAAAGGAGAGGGATCATGG + Intronic
939648659 2:144734751-144734773 ATGTGAAGCAAGAGGGAACATGG + Intergenic
940159010 2:150691904-150691926 TTGGGCATGGAGAGGGAAAAGGG + Intergenic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941503364 2:166309122-166309144 ATGAGAGTGAAGAGGGAACAGGG + Intronic
941585241 2:167350570-167350592 CGCTGGATGCAGAGGGAACAGGG - Intergenic
944747651 2:202674674-202674696 CTGTGGATGGAGAAGAAACTGGG - Intronic
945270518 2:207934376-207934398 ATGTGAATGGAGTGGTATCATGG - Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
948201667 2:236133728-236133750 GTGTGAATGGTGGGGAAACAAGG - Intergenic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
948642682 2:239385519-239385541 CTGAGACTTCAGAGGGAACAGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169381834 20:5113802-5113824 CTGTGAGTGGAGAAGGAAATAGG - Intergenic
1169448183 20:5689532-5689554 CTTTGAAAGTAGAGGGCACAGGG + Intergenic
1169539897 20:6588242-6588264 TTGTAAGTGGAGAGAGAACAAGG - Intergenic
1169713296 20:8588873-8588895 TTGTGACTGGAGAGGGAATGGGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1171121366 20:22571830-22571852 CTGGGAAGGGAGAGGCAAGAGGG + Intergenic
1172331080 20:34076679-34076701 CTGGGAGTGGAGGGGGGACAGGG - Intronic
1172681523 20:36719502-36719524 GTGGGAATGGAGAGGTCACAGGG + Intronic
1173416144 20:42857879-42857901 CTGGGATTGTAGAGGGAATAGGG - Intronic
1173823815 20:46034925-46034947 CTGAGAAGGGAGAGGGGTCAGGG - Intronic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1175117307 20:56691631-56691653 TGGTGAAGGGAAAGGGAACATGG - Intergenic
1177227052 21:18271083-18271105 CTGTGTATGGAGGGGAAAAAAGG - Intronic
1178289427 21:31354331-31354353 CTGAGAAAGGTGAGTGAACAAGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178461805 21:32809130-32809152 CTGGGAAAGGAGAGGCATCACGG + Intronic
1178466545 21:32853650-32853672 CTCTCAGTGGAGAGGGAACATGG + Intergenic
1178599492 21:33983801-33983823 ATGTAAGAGGAGAGGGAACAGGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179807957 21:43852031-43852053 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179808028 21:43852404-43852426 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180844311 22:18973063-18973085 AGGTGAGTGGAGAGGGGACAGGG + Intergenic
1181057160 22:20265648-20265670 AGGTGAGTGGAGAGGGGACAGGG - Intronic
1181494639 22:23281150-23281172 CTGTGTATGAAAAGGGCACAGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181994829 22:26869065-26869087 CTATGGATGGAGAGGGAGTAGGG + Intergenic
1183324647 22:37184683-37184705 CGCTGAGTGGAGTGGGAACAGGG - Intronic
1183652062 22:39162224-39162246 CTGTGAATCAAGTGGGAAGATGG + Intergenic
1183712139 22:39511265-39511287 CTGAGAATGAAGACAGAACACGG - Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1185420887 22:50733762-50733784 GTGTGCATGGGGAGGGAGCAGGG - Intergenic
949474603 3:4431503-4431525 CTCTCAGTGGAGAGGGGACATGG - Intronic
949722555 3:7007538-7007560 CTGGGAATGGAGAAAGAAAAGGG - Intronic
950476358 3:13217473-13217495 GTGTGAATGGAGAGAAAACTTGG - Intergenic
950534097 3:13569455-13569477 CTGAGACTGGAGTGGGGACAGGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950918583 3:16669819-16669841 CTGTGAGTGGAAATGGCACATGG - Intronic
951105875 3:18742022-18742044 CTGTTAATGGAGGGGATACAGGG - Intergenic
952315842 3:32231631-32231653 GAAGGAATGGAGAGGGAACAGGG + Intergenic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953616708 3:44497044-44497066 CTGGGGATGGAAAGAGAACAGGG + Intergenic
953858348 3:46519532-46519554 CTGTGAAGGGAGAGAGAAGAGGG - Intronic
954578916 3:51692509-51692531 GTGGGAATGGAGAGGAGACAGGG - Intronic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955759802 3:62267068-62267090 GTATTAATGGGGAGGGAACAGGG + Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958540533 3:95465071-95465093 CTCTCAGTGGAGAGGGCACATGG + Intergenic
959651857 3:108757999-108758021 CTGAGAATGGTGGGGGAAAAAGG - Intergenic
959858509 3:111189922-111189944 CAGTCACTGGAGAGGGGACAGGG + Intronic
960079060 3:113521750-113521772 TTAAGAATGGAAAGGGAACAGGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961034666 3:123634240-123634262 CCGGGCTTGGAGAGGGAACAGGG + Intronic
964717178 3:159734910-159734932 CTGTGAAGGGAATGGGCACAGGG - Intronic
965296675 3:166955799-166955821 CTGTGAGTTGAGTGGGAGCAGGG - Intergenic
965561662 3:170067619-170067641 CTGTGATTGCAGAGGTCACATGG - Intronic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
966341032 3:178924826-178924848 CAGAGTATTGAGAGGGAACATGG + Intergenic
968769122 4:2492583-2492605 CTGTGAATGGTATGGGAAGATGG + Intronic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
970363901 4:15338637-15338659 CTGTGAATGCAGAGAAAAGATGG - Intergenic
971483322 4:27133886-27133908 CTTTCCAGGGAGAGGGAACATGG + Intergenic
971492091 4:27223887-27223909 TTGTGAGTTCAGAGGGAACACGG + Intergenic
971995450 4:33958069-33958091 CAGAGCATTGAGAGGGAACAAGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972929898 4:44059423-44059445 CTATGAATGATGAGGAAACAAGG - Intergenic
973770803 4:54204655-54204677 ATGTAAATTGAGAGAGAACATGG + Intronic
975163265 4:71147907-71147929 CTGTGACTCTAGAGGGAACTGGG + Intergenic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976539523 4:86257372-86257394 CTGTGAGTGGATATGGTACATGG - Intronic
977408660 4:96633139-96633161 CTGTGGATGGAGGGGGGAAATGG - Intergenic
980029158 4:127805737-127805759 ATGTGATTGAATAGGGAACAAGG - Exonic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981606332 4:146545376-146545398 CAGAGAATTGAGAGGGAGCATGG - Intergenic
982086456 4:151841353-151841375 CTTTGACTGGAGAGGGAGCCAGG - Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
984617470 4:181914938-181914960 CTGTAAATGGACAGGTCACAAGG - Intergenic
985275075 4:188230233-188230255 CAGTGAATGAATAGAGAACAAGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
988361329 5:30239864-30239886 CTCTCAGTGGAGAGGGGACATGG - Intergenic
988546057 5:32158520-32158542 CTGTGAATGGAAAGGAGATAGGG - Intronic
988782733 5:34538140-34538162 CTTTCAGTGGAGAGGGGACAGGG + Intergenic
989487949 5:42013587-42013609 GTGAGAATGGAGAGGGAGAAAGG - Intergenic
990908409 5:60828016-60828038 CTGTTAGGGGAGAGGGAACTAGG - Intronic
991487622 5:67154190-67154212 CTGTAAATGGAGAGAGAGAAAGG + Intronic
992497237 5:77305718-77305740 CTGAGAATGGAGGGTGGACAGGG + Intronic
993699812 5:91105214-91105236 CAATGAATGGACAGGGAAAATGG - Intronic
993896332 5:93539585-93539607 CAGAGACTGGAGAGGGATCAGGG + Intergenic
997731895 5:136187568-136187590 CTGTGATTGGGGAGGCAATATGG + Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
1000772437 5:165372271-165372293 CTGGGTATGGAGGGGGACCAAGG - Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001756131 5:174171719-174171741 CTGAGGATGGAAAGTGAACAAGG + Intronic
1002403744 5:179012189-179012211 CTTTTAATGGGGAGGTAACATGG + Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1005018483 6:21395689-21395711 CTTTGAATGGAGATGAAAGATGG + Intergenic
1005130819 6:22505678-22505700 CTCTGAATGCAGAGGCATCAAGG - Intergenic
1006104869 6:31710462-31710484 CTGGGGATGGAGAGGAAACACGG + Intronic
1006192520 6:32218298-32218320 GTGTGAAAGGCCAGGGAACAGGG + Intronic
1011285217 6:85715576-85715598 CAGACAATGGAGAGTGAACAAGG + Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013176047 6:107677899-107677921 TTGTGAATGGAAAGGGCATAGGG - Intergenic
1014547107 6:122746851-122746873 CTCTGAAAGGAGAGGGAAAGGGG - Intergenic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1016047962 6:139499719-139499741 CTGTCAATATAGAGGAAACAGGG - Intergenic
1016071467 6:139744124-139744146 CTGTGCATGGATATGGAAAAGGG + Intergenic
1016381984 6:143493654-143493676 CAGAGATTGGAGAGGGAGCATGG - Intergenic
1017155647 6:151320515-151320537 CTGGGAATGGACAGGGATTAGGG - Intronic
1017368361 6:153672410-153672432 CTGTGTATGGACATGGTACATGG - Intergenic
1017535899 6:155348318-155348340 CAGGGCATTGAGAGGGAACATGG - Intergenic
1017673725 6:156793183-156793205 CTGTGATTGGAGAAGAAGCAAGG + Intronic
1017782777 6:157729340-157729362 CTGTGAATGCAGAGTGCTCAAGG - Intronic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1019026844 6:168973081-168973103 GTGTGTATGGAGAGAGAAAAAGG - Intergenic
1019065459 6:169292335-169292357 CTGTGCTTGGAGTGGGGACAAGG + Intergenic
1021291312 7:18848479-18848501 GTGTGCATGGAGAGAGAGCAAGG - Intronic
1023081463 7:36530513-36530535 CTCTGAAGAGAGAGGAAACAGGG + Exonic
1023670641 7:42572565-42572587 CTTAGAATAGAAAGGGAACAAGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024631690 7:51254158-51254180 TTGTCAATGAAGAGGGGACATGG - Intronic
1025111760 7:56223056-56223078 CGGTGGAGGGAGAGGTAACAGGG + Intergenic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1027468407 7:78543207-78543229 ATGTGAATGTAGAGAGAAAAAGG + Intronic
1027941414 7:84685752-84685774 ATGAAGATGGAGAGGGAACAAGG + Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030242687 7:107346362-107346384 CTGTGACTGGAAAGGAAACAAGG + Intronic
1030870499 7:114749703-114749725 ATGTGAATTGTGAGGGAAAATGG + Intergenic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1032397792 7:131602967-131602989 CAGTGAATGGAAAGGGAAAGTGG + Intergenic
1032962585 7:137054015-137054037 TTGTGAATGGATAGACAACATGG - Intergenic
1033108747 7:138556537-138556559 CTGTGAATGTAGGGGGAAATAGG + Intronic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1033399917 7:141012789-141012811 TTGTCAATGAAGAGGCAACAGGG + Intronic
1033706372 7:143889555-143889577 CTGTAACAGGAGAGGAAACATGG + Intronic
1034364273 7:150533247-150533269 CAGAGCATTGAGAGGGAACATGG - Intergenic
1036108439 8:5870586-5870608 CTTTGAATGGAGAGGAGAGATGG + Intergenic
1037659819 8:20916928-20916950 CTGGGAATTGAGGGGGAATAAGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039778922 8:40764479-40764501 CTATGAATGGGGTGGGAGCAGGG + Intronic
1040323232 8:46328857-46328879 CTGGGAATGGAGAGGCATCCTGG + Intergenic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1040975911 8:53194484-53194506 CTGGCAACGGAGAGGGAGCAGGG + Intergenic
1041126335 8:54644085-54644107 CTGTGAATGGAGAGGAATTTTGG - Intergenic
1041825610 8:62093522-62093544 TTGTTAATGGAGAGAAAACACGG + Intergenic
1041837431 8:62232300-62232322 ATAAGAATGGAAAGGGAACAAGG - Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043302237 8:78748000-78748022 CTTTGAAGAGAGAGGGATCATGG + Intronic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1045219561 8:100185195-100185217 GTGGGAGTGGAGAAGGAACAAGG - Intronic
1046863378 8:119119181-119119203 ATGTGAGAGGAGAGGAAACAAGG - Intergenic
1046950903 8:120018910-120018932 CAGTGAATAGTGAGTGAACAAGG - Intronic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1047924877 8:129672893-129672915 CTGAGAAAGCAGAGAGAACAAGG - Intergenic
1049042705 8:140124588-140124610 CTGTGAATGGCCGGGGCACATGG - Intronic
1049056595 8:140241897-140241919 CTGGGAAAGGAGAGAGCACACGG + Intronic
1049136549 8:140906656-140906678 CTGGGAAGGGAAAGGGTACAGGG + Intronic
1049634827 8:143682057-143682079 CTTTCAGTGGAGAGGGGACATGG + Intergenic
1049934165 9:484724-484746 TGGGGTATGGAGAGGGAACACGG + Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052924247 9:34001424-34001446 CTCTGATTGGTGAGTGAACACGG + Intronic
1053432816 9:38054420-38054442 ATGTGACTGGATGGGGAACAAGG - Intronic
1053443820 9:38136393-38136415 ATGGGAAGGGAAAGGGAACAGGG - Intergenic
1055132799 9:72794375-72794397 CAGAGCATTGAGAGGGAACATGG + Intronic
1055671119 9:78606917-78606939 GTGTGAGGGGAGAGGGTACATGG + Intergenic
1055920676 9:81457455-81457477 CTGTGAAAGGATTAGGAACACGG + Intergenic
1057926538 9:99156547-99156569 TTTTGTAGGGAGAGGGAACAGGG - Intergenic
1059318858 9:113450597-113450619 CTGGGAATGGAGAGAGATCTAGG + Intronic
1059447586 9:114348490-114348512 CTGTGAGTGGAGAGCGGACAGGG + Intronic
1060686418 9:125617808-125617830 CTGTGAGTGGTCAGGGAGCAAGG + Intronic
1203782453 EBV:108185-108207 CTGGGAATGGAGAGGGGAGTGGG + Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1186081238 X:5935460-5935482 CAGTGAATGCAGAGAGGACAGGG + Intronic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1188842952 X:35037972-35037994 CAGAGCATTGAGAGGGAACATGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190218868 X:48498028-48498050 CTCTGAATGGAGACAGAACATGG - Intergenic
1192254254 X:69442608-69442630 CAGAGAACTGAGAGGGAACATGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193299138 X:79868109-79868131 CAGAGAATTGAGAGGAAACATGG + Intergenic
1194137179 X:90160831-90160853 CAGAGCATTGAGAGGGAACATGG - Intergenic
1195403041 X:104482289-104482311 CTGTGAGTGGAAAGAAAACAAGG - Intergenic
1195473422 X:105259315-105259337 CAGAGCATTGAGAGGGAACAGGG - Intronic
1195706115 X:107739036-107739058 CTGGGAAAGGAGAGGAAATAAGG + Intronic
1196715986 X:118811518-118811540 CTGTCAAGGGACAGGGGACAGGG + Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197595027 X:128454399-128454421 CTGTGAATTGTGAGTGATCAGGG - Intergenic
1197694798 X:129539622-129539644 GTGTGAATGGAGAGAAAATAAGG + Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198088868 X:133307969-133307991 CTGGGAATGGAGGGGGAAGCTGG + Intronic
1198091387 X:133334271-133334293 CTGTGAAGTGATAGGAAACAAGG + Intronic
1198308062 X:135402083-135402105 TTGAAAATGGACAGGGAACAAGG + Intergenic
1199418563 X:147615976-147615998 CTGTGAAAGGAGAGTGATAATGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1200482912 Y:3730755-3730777 CAGAGCATTGAGAGGGAACATGG - Intergenic