ID: 1148517440

View in Genome Browser
Species Human (GRCh38)
Location 17:48233562-48233584
Sequence ATAAGATTACTGGCCAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 483}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148517440 Original CRISPR ATAAGATTACTGGCCAAGTG TGG Intronic
902051009 1:13563610-13563632 ATAAGGGAACTGGACAAGTGGGG - Intergenic
902300490 1:15499025-15499047 ATAAGATCATTGGCCAGGGGCGG - Intronic
904741068 1:32676312-32676334 AGCTGATTACTGGCCAGGTGTGG + Intronic
905220030 1:36439228-36439250 AAAAGATTACTGGCTGGGTGTGG + Intronic
905418764 1:37824405-37824427 ATGAGATTACAGGCCAGGTGTGG + Intronic
905600400 1:39245001-39245023 ATAAAACTACTGGCCAAGCACGG - Intronic
906010319 1:42517371-42517393 ATAACACTACTGGCCAAGTGTGG - Intronic
906389416 1:45401104-45401126 CTGACACTACTGGCCAAGTGTGG + Intronic
907612158 1:55882239-55882261 AAAACATTAGTGGCCAGGTGCGG - Intergenic
907818685 1:57945568-57945590 ATAATAAAACAGGCCAAGTGTGG - Intronic
908013359 1:59806480-59806502 AAAAGTTTCCTGGCCAAGCGCGG - Intergenic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
909841957 1:80338426-80338448 AAAAGCTTCCTGGCCAGGTGCGG + Intergenic
909924101 1:81418459-81418481 ATAAGATTCCAGGCCGAGTGTGG + Intronic
910297708 1:85667640-85667662 AAAAGAATAATGGCCATGTGTGG + Intronic
910475599 1:87602910-87602932 ATAAGATAATTGGCCAGGTGCGG + Intergenic
910904909 1:92164940-92164962 AAAAAAGTACTGGCCAGGTGAGG - Intergenic
911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG + Intergenic
911927167 1:103848392-103848414 ATATAATTACAGGCCAAGTGCGG - Intergenic
911952892 1:104198715-104198737 AAGAAATTATTGGCCAAGTGTGG - Intergenic
912417070 1:109516543-109516565 ATAAGAATACTTGCCTAATGGGG + Intergenic
913244179 1:116857044-116857066 ATAATAAAACTGGCCAGGTGTGG - Intergenic
914221655 1:145687227-145687249 ATAAAATTGCTGGCCGAGCGTGG + Intronic
914510860 1:148330635-148330657 ATACAATTGATGGCCAAGTGGGG - Intergenic
915621123 1:157085058-157085080 ATGAGATTAAAGGCCGAGTGTGG + Intergenic
916717823 1:167460109-167460131 ATAAGATTATGGGCCAGGTGTGG + Intronic
917108379 1:171518791-171518813 AAAAGTTTAAAGGCCAAGTGAGG - Intronic
917956846 1:180108331-180108353 TTAATATTACAGGCCAAGAGAGG + Intronic
918000748 1:180492956-180492978 ATAAGAATACTGGCCAGGCTTGG + Intronic
918252566 1:182716414-182716436 ATAAAAATACAGGCCAGGTGTGG - Intergenic
919176080 1:194020358-194020380 ATAATCTTATTGCCCAAGTGTGG + Intergenic
919400848 1:197114727-197114749 ATAAAATAACTAGCCAAGTGTGG - Intronic
920116442 1:203625031-203625053 AAAACATTACTGGCCGGGTGCGG + Intergenic
921107135 1:211993387-211993409 GTAAGACTACAGGCCAGGTGCGG + Intronic
921125702 1:212175950-212175972 ATAATACTGCTGGCCAGGTGCGG - Intergenic
921170878 1:212548600-212548622 AAAATATTATTGGCCAGGTGCGG - Intergenic
921239400 1:213162571-213162593 ATAACATTGCTGGCCAAGTATGG - Intronic
921640162 1:217543557-217543579 AAAACATTCCTGGCCAGGTGTGG - Intronic
921868815 1:220115270-220115292 ATAAAATTCATGGCCAGGTGCGG + Intronic
922295086 1:224243070-224243092 ATAAAATTACTGGCCAGGTACGG - Intronic
922521596 1:226257238-226257260 TTAACATTTCTGGCCAGGTGTGG - Intronic
923004931 1:230040940-230040962 ATAACATTTCTTCCCAAGTGAGG + Intergenic
923113126 1:230909211-230909233 ATATATTTACTGGCCAGGTGAGG + Intronic
923434455 1:233955132-233955154 ATAAGAAGACTGGCCTGGTGCGG - Intronic
923565157 1:235070899-235070921 ATAAAATTATTAGCCAGGTGTGG - Intergenic
923908637 1:238414544-238414566 ATAAAAAGACTGGCCAGGTGTGG + Intergenic
924059327 1:240155178-240155200 CAAAGATTAGTGGCCAGGTGTGG - Intronic
924304493 1:242673136-242673158 ATAAGTATGTTGGCCAAGTGTGG + Intergenic
924355619 1:243172342-243172364 ATAAGAATTCAGGCCAAGTGCGG + Intronic
924460912 1:244257866-244257888 TTATCGTTACTGGCCAAGTGTGG + Intergenic
924529894 1:244884536-244884558 ATAATATTTCTGGGCAGGTGTGG + Intergenic
924645660 1:245875169-245875191 ATAAAAGTACTGGCCATGTTTGG + Intronic
1062864133 10:835686-835708 CTAAAATTACTGCCCAAGTCGGG + Intronic
1063989516 10:11544777-11544799 TTTAGATTACTGGCCAGGCGTGG - Intronic
1064384179 10:14876696-14876718 AAAAGATTTCTGGGTAAGTGGGG + Intergenic
1064451892 10:15449428-15449450 AAGAAATTACTGGCCAGGTGCGG - Intergenic
1064664966 10:17641278-17641300 ACAAAAATACTGGCCAAGTGTGG - Intergenic
1064688789 10:17892719-17892741 AGAAGATAACTGGCCAGGCGTGG + Intronic
1065066592 10:21973810-21973832 ATATGATTTTTGGCCAGGTGCGG + Intronic
1065764011 10:29009543-29009565 AACAGATTATTGGCCAGGTGCGG - Intergenic
1066541838 10:36456176-36456198 AAATGAGAACTGGCCAAGTGCGG + Intergenic
1066605695 10:37168170-37168192 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066606478 10:37179962-37179984 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066607252 10:37191703-37191725 TTAAGATTTCAGGCCAGGTGTGG + Intronic
1066973924 10:42346458-42346480 TTAAGAAGACTGGCCAGGTGTGG + Intergenic
1067859435 10:49829549-49829571 AAAACATCACTGACCAAGTGTGG + Intronic
1068261054 10:54582620-54582642 AGAACATTACTGGCAAGGTGTGG + Intronic
1068360856 10:55973934-55973956 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
1068592252 10:58863991-58864013 ATAAGGGTACTGGGCAGGTGGGG + Intergenic
1068884155 10:62081091-62081113 ATGCCACTACTGGCCAAGTGTGG - Intronic
1069393545 10:67963498-67963520 ATAACATTACAGTCCAGGTGCGG - Intronic
1070869683 10:79739740-79739762 ATAAAATAATTGGCCATGTGTGG + Intergenic
1071063396 10:81600829-81600851 TTAAGATTACTGGCCGGGTGCGG - Intergenic
1071636602 10:87261949-87261971 ATAAAATAATTGGCCATGTGTGG + Intergenic
1071658647 10:87476000-87476022 ATAAAATAATTGGCCATGTGTGG - Intergenic
1072150548 10:92679522-92679544 TTAATAGTACTGGCCAGGTGTGG + Intergenic
1072261717 10:93682508-93682530 AAAAAAGTTCTGGCCAAGTGTGG + Intronic
1073157763 10:101361394-101361416 AAAATATTGCTGGCCAGGTGCGG - Intronic
1073298860 10:102458447-102458469 ACAAGATTGCTGGCCAGGTGCGG - Intergenic
1073558594 10:104478164-104478186 ATAGGATTACTGGCCAAATAAGG - Intergenic
1073639631 10:105238360-105238382 GTAAAATTACTGGCTAAGTCAGG + Intronic
1073726198 10:106234005-106234027 ATAATATTACTTGCCAGGTATGG + Intergenic
1074548084 10:114417348-114417370 ATAGACTTTCTGGCCAAGTGTGG - Intergenic
1074806137 10:117054695-117054717 ATAAGGATGCTGGCCAGGTGCGG - Intronic
1074844423 10:117384644-117384666 AGAAGATGGCTGGCCAGGTGCGG - Intergenic
1075932869 10:126314103-126314125 ATAAGATGAGAAGCCAAGTGTGG + Intronic
1078485947 11:11723313-11723335 TTAAGATTTCTGGCCAGGCGCGG + Intergenic
1079960514 11:26917834-26917856 ATAAGATTTCTGGCAATGAGAGG + Intergenic
1080038306 11:27732314-27732336 ATAAGCTCACAGGCCAGGTGCGG - Intergenic
1081123958 11:39300052-39300074 ATAAAATTTATGGCCAGGTGCGG - Intergenic
1081916523 11:46735022-46735044 TAAAAATTATTGGCCAAGTGCGG + Intronic
1081924532 11:46813842-46813864 AGAAGATTATAGGCCAGGTGCGG + Intronic
1082763105 11:57145539-57145561 ACCAGAAAACTGGCCAAGTGGGG - Intergenic
1083252832 11:61479237-61479259 ATTAAATTACTGGCCGAGCGCGG + Intronic
1083335958 11:61921896-61921918 ATAACATTTGTGGCCAGGTGCGG + Intergenic
1085238087 11:75030661-75030683 CTAAAATTACTGGCCTAGAGAGG - Intergenic
1086270123 11:85053398-85053420 ATAAGATGACTGATCCAGTGAGG + Intronic
1087271931 11:96120739-96120761 ATTAGAATATCGGCCAAGTGGGG + Intronic
1087780446 11:102296297-102296319 ATAAGAATAGTGGCCGGGTGCGG + Intergenic
1087864040 11:103201115-103201137 ACAAGATTACTGGCCAGACGCGG - Intronic
1088545394 11:110953705-110953727 AGGAGGCTACTGGCCAAGTGAGG - Intergenic
1089525877 11:119096117-119096139 ATAAAATAATTAGCCAAGTGTGG - Intergenic
1089994943 11:122897520-122897542 ATAATAGTACTGGCCAGGTGTGG - Intronic
1090367039 11:126215406-126215428 TTAAGATTTCTGGCCAGGCGCGG + Intronic
1091496016 12:973357-973379 TTAAAATTTCTGGCCAGGTGTGG - Intronic
1092832789 12:12461460-12461482 ATAGGAATGCTGGCCAGGTGCGG - Intronic
1093083232 12:14837803-14837825 GTAAAATTATTGGCCAAGTGCGG - Intronic
1093645484 12:21581322-21581344 ATAACATAACTGGCCAGGTCAGG - Intronic
1093852117 12:24053281-24053303 ATAAAAAAATTGGCCAAGTGTGG - Intergenic
1094693855 12:32797147-32797169 ATAATATTATTGGCCAGGTTCGG + Intronic
1094825833 12:34268371-34268393 ATAAGGGAACTGGGCAAGTGGGG - Intergenic
1095765936 12:45895821-45895843 ATGGAATTACTGGCCAGGTGCGG - Intronic
1095866778 12:46980640-46980662 AAAAGAGTACAGGCCAGGTGTGG - Intergenic
1095984470 12:47990298-47990320 TTAAGATTAGGGGCCAGGTGCGG - Intronic
1096467484 12:51855329-51855351 AAAAGTTTCCTGGCCAGGTGCGG + Intergenic
1096997341 12:55846973-55846995 ATGATAATACTGGCCAGGTGCGG - Intergenic
1097852151 12:64422744-64422766 AAAAGAAAACTAGCCAAGTGTGG + Intronic
1098028559 12:66231219-66231241 ATATGTTTACTGGCCAGGTGTGG + Intronic
1098270658 12:68766873-68766895 AAGAAATTACTGGCCAGGTGTGG - Exonic
1098680811 12:73351460-73351482 CTGAGGTTACAGGCCAAGTGTGG + Intergenic
1099211159 12:79790157-79790179 AATACATTTCTGGCCAAGTGTGG + Intronic
1100966455 12:100018502-100018524 ACAATTTTACTGGACAAGTGCGG + Intergenic
1100989765 12:100239364-100239386 AAAAAATTATTGGCCAGGTGTGG - Intronic
1101450433 12:104772452-104772474 AAAAAATATCTGGCCAAGTGTGG - Intergenic
1102562201 12:113770135-113770157 ATAAAATAATTAGCCAAGTGTGG - Intergenic
1103390651 12:120570543-120570565 ATAAGAGTACTGACCATGTGAGG + Intronic
1103514642 12:121499655-121499677 ATAATAATAATGGCCAGGTGTGG + Intronic
1103694594 12:122804492-122804514 AAAAGGTCATTGGCCAAGTGAGG + Intronic
1104076765 12:125396797-125396819 ATGACAGTACTGGCCAGGTGTGG - Intronic
1105032308 12:132892447-132892469 ATAAGGGAACTGGGCAAGTGGGG - Intronic
1105350582 13:19611530-19611552 ATAAAATTCTTGGCCAGGTGCGG - Intergenic
1105465945 13:20640280-20640302 AAAAAATTAATGGCCAGGTGTGG + Intronic
1107463426 13:40627540-40627562 ATAACTTTCCTGGCCAAGCGTGG + Intronic
1107843602 13:44487206-44487228 AAGAAATTACTGGCCAGGTGTGG + Intronic
1108003523 13:45925683-45925705 ATAAGAACTCTGGCCAGGTGTGG - Intergenic
1108382465 13:49867616-49867638 ATAGAATTACCGGCCAGGTGTGG - Intergenic
1108864529 13:54906602-54906624 ATTAAGTTACTGGCCAGGTGTGG + Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1110002879 13:70228197-70228219 ATATGATTTTTGGCCAGGTGTGG - Intergenic
1111960428 13:94804217-94804239 ACGAGGTTATTGGCCAAGTGTGG + Intergenic
1112617336 13:101018906-101018928 ATATGATTCCTGACTAAGTGAGG + Intergenic
1112934129 13:104778000-104778022 ATAAAAGTCCTGGCCAGGTGTGG - Intergenic
1114013795 14:18405035-18405057 TTAAGAAGACTGGCCAGGTGTGG + Intergenic
1114189896 14:20432629-20432651 AAAAAATTACTGGCCAGGCGCGG + Intronic
1114293372 14:21307062-21307084 ATAACAATAGTGGCCGAGTGCGG - Intronic
1114467586 14:22934739-22934761 AGAATATTTATGGCCAAGTGCGG - Intergenic
1115784702 14:36811493-36811515 ATAAAATAACTAGCCAGGTGTGG + Intronic
1116374500 14:44181756-44181778 ATAGGATTACTGTCAAAGTTTGG + Intergenic
1117111276 14:52458266-52458288 ATGAGACAACTGGCCAGGTGCGG + Intronic
1117485437 14:56192143-56192165 ATAAAAATCTTGGCCAAGTGCGG - Intronic
1118591443 14:67404941-67404963 ATAAGAATGGTGGCCAGGTGCGG + Intronic
1119189844 14:72673718-72673740 ATGAGATTAGTGGCCAATGGCGG + Intronic
1119236599 14:73025357-73025379 ATGAGATTTCTGGCCAGGTGCGG - Intronic
1119258020 14:73216468-73216490 ATAAGATGATAGGCCATGTGTGG + Intronic
1119590746 14:75885198-75885220 ATAAAAAAACTGGCCAGGTGCGG + Intronic
1119783407 14:77294587-77294609 ATCAGATCTCTGGCCAGGTGCGG - Intronic
1119846234 14:77832271-77832293 ATCACATCACTGGCCAGGTGCGG - Intronic
1121083916 14:91130594-91130616 AAAAGATTCTTGGCCAGGTGTGG - Intronic
1121700455 14:95949967-95949989 ATAAAAATATTGGCCAGGTGCGG - Intergenic
1121853905 14:97248841-97248863 ATAATATTACTTGTCAAATGGGG + Intergenic
1121983885 14:98480628-98480650 ATAAGACTCAAGGCCAAGTGTGG + Intergenic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1123767910 15:23500218-23500240 ATAAGAAAGCTGGCCAGGTGTGG + Intergenic
1124495209 15:30182235-30182257 ATAAGTATACTGGCTGAGTGTGG + Intergenic
1124748362 15:32356410-32356432 ATAAGTATACTGGCTGAGTGTGG - Intergenic
1125299997 15:38245085-38245107 AAGGGATTACTGGCCAGGTGTGG + Intergenic
1125550777 15:40542865-40542887 AAAAGATGCCTGGCCAGGTGGGG + Intronic
1125570976 15:40717939-40717961 ATTTTATTACTGGCCAGGTGTGG + Intronic
1125632528 15:41159078-41159100 ATAATTTTTCTGGCCGAGTGTGG + Intergenic
1125915058 15:43479101-43479123 ATAAGATTAGTAGTCAAGTGTGG + Intronic
1125917434 15:43501502-43501524 ATCAAATTACTGGCCAAGCACGG - Intronic
1125997734 15:44180492-44180514 AAAAGAATACTGGCCAGGCGCGG + Intronic
1126565333 15:50090876-50090898 ATCACATTTCAGGCCAAGTGAGG - Intronic
1126711454 15:51461539-51461561 ATAAGATTTCTGGTCAATTAGGG - Intronic
1126759803 15:51959292-51959314 GTAAAATTACTGGCCGGGTGTGG - Intronic
1127204010 15:56693903-56693925 AGAAGATTCCTGGCCTAGCGTGG - Intronic
1127263603 15:57343893-57343915 ATTAGAGCACGGGCCAAGTGTGG - Intergenic
1127426354 15:58862766-58862788 ATAGGATTTCTGGCCAGGTGCGG + Intergenic
1127521481 15:59747062-59747084 ATAAGATACCTGGACCAGTGGGG + Intergenic
1127812810 15:62579198-62579220 AAAAAATCACTGGCCATGTGAGG + Intronic
1128022520 15:64404599-64404621 ATAAAATTACAGGCCGAGCGCGG - Intronic
1128433848 15:67626227-67626249 ATCACATTTCAGGCCAAGTGTGG + Intronic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1129095807 15:73206195-73206217 AAAAGTTTACAGGCCAGGTGTGG - Intronic
1129219972 15:74126636-74126658 ATAAGAGTACTGACCAGGCGCGG - Exonic
1129558171 15:76536206-76536228 AAAATATTTTTGGCCAAGTGCGG + Intronic
1132499350 16:278306-278328 AAAAAATTAGTGGCCAGGTGCGG - Intronic
1132820727 16:1868563-1868585 AAAATATTATTGGCCAGGTGCGG + Intronic
1134188802 16:12105510-12105532 ATTAGATTCCTGGCCGGGTGTGG - Intronic
1135018531 16:18944414-18944436 AAAAAAATAGTGGCCAAGTGCGG - Intergenic
1135344839 16:21680221-21680243 ATAAGATTACAGGCCGGGCGCGG + Intronic
1135594628 16:23732382-23732404 ATAATATAACAGGCGAAGTGTGG + Intergenic
1135691966 16:24545360-24545382 AAAAGACTACTGGCCAGGCGCGG - Intronic
1136180626 16:28549241-28549263 ATAATTTTTCTGGCCAGGTGCGG - Intergenic
1137490218 16:48926152-48926174 ATAAGATTCCTGGCCAGGCGTGG + Intergenic
1138181571 16:54944008-54944030 AGAAGATTAGTGGCAACGTGGGG + Intergenic
1138548187 16:57731790-57731812 ATAAGACTTATGGCCAGGTGTGG + Intronic
1139204540 16:65014510-65014532 AAGAGCTTACTGGCCACGTGGGG + Intronic
1140071914 16:71657682-71657704 ATAATATTATTGGCCGTGTGCGG - Intronic
1140101973 16:71925665-71925687 AAAAAAGTACTGGCCAGGTGTGG + Intronic
1140809138 16:78560350-78560372 ATAACATTAGTGGCCAGGTGCGG + Intronic
1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG + Intronic
1141605134 16:85148548-85148570 ATAAGGAAACTGGCCAGGTGCGG + Intergenic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1144576435 17:16432594-16432616 ATAAAAATATTAGCCAAGTGTGG - Intronic
1146353213 17:32113043-32113065 AGATGATTACTGGCCAGGCGTGG - Intergenic
1146366668 17:32234165-32234187 ATGAAATTACAGGCCAGGTGCGG - Intronic
1146550077 17:33772899-33772921 ATGAGTTTGTTGGCCAAGTGTGG + Intronic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1147023471 17:37559397-37559419 AGAAAAAGACTGGCCAAGTGTGG + Intronic
1147487562 17:40832191-40832213 ATAAAATTTCTGGCCAAGGGTGG - Intronic
1147799323 17:43072095-43072117 ATAAGAGTACAGGCCGGGTGCGG + Intronic
1148320582 17:46748400-46748422 ATAAGGTTAGAGGCCAGGTGTGG - Intronic
1148334163 17:46830534-46830556 ATATGATTTCTGGCCAGGTGTGG - Intronic
1148374448 17:47130069-47130091 ATGATTTTACTGGCCAGGTGCGG + Intronic
1148517440 17:48233562-48233584 ATAAGATTACTGGCCAAGTGTGG + Intronic
1148640097 17:49181006-49181028 ATGAGATTTTTGGCCAGGTGTGG - Intergenic
1150255034 17:63737829-63737851 ATAAAAAAACTGGCCAGGTGTGG + Intronic
1150910975 17:69387169-69387191 ACAGGATTTCTGGCCAGGTGCGG + Intergenic
1151316149 17:73323948-73323970 ATAAGATCCCTGGGCAACTGAGG + Intergenic
1155137956 18:23015186-23015208 GAAACATTACTGGCCAGGTGTGG - Intronic
1155695443 18:28679961-28679983 TTAAGAATACTGGCCAGGTGTGG + Intergenic
1156091593 18:33478467-33478489 AGAAGACTCCTGGCCAGGTGCGG - Intergenic
1157689601 18:49670243-49670265 AGAAGATCGCTGGCCAGGTGCGG - Intergenic
1157872625 18:51244651-51244673 AGAACAAAACTGGCCAAGTGTGG - Intergenic
1158577201 18:58648450-58648472 AATAGATTACAGGCCAAGTACGG - Intergenic
1158720572 18:59920631-59920653 ATAAGATTTAAGGCCAGGTGCGG - Intergenic
1158734319 18:60062483-60062505 AAAACCTTACTGGCAAAGTGGGG + Intergenic
1161247990 19:3265180-3265202 ATAAGAAAACTAGCCAGGTGTGG + Intronic
1161832618 19:6618824-6618846 ATATGAAAACAGGCCAAGTGTGG + Intergenic
1162581208 19:11531627-11531649 AAAAGACTACTGGCCTGGTGTGG - Intergenic
1162636978 19:11976574-11976596 AAAAAATTGCTGGCCAGGTGTGG + Intronic
1163247525 19:16106271-16106293 ATGAGATTACAACCCAAGTGGGG - Intergenic
1163381739 19:16973637-16973659 AAAATATTTCTGGCCAGGTGTGG - Intronic
1163814480 19:19455858-19455880 AAAAGTTTACTGGCCAGGCGTGG + Intronic
1163837125 19:19581811-19581833 ATAAGGTTATTGGCCAAGGAAGG + Intronic
1165009049 19:32830192-32830214 AGTAAATTACTGGCCAGGTGTGG - Intergenic
1165041106 19:33068196-33068218 AAAAGATTATTGGCCAGGCGTGG - Intergenic
1166078726 19:40429808-40429830 AAAAAAAAACTGGCCAAGTGCGG - Intergenic
1166833861 19:45654883-45654905 CAAAGTTAACTGGCCAAGTGTGG + Intergenic
1166903033 19:46081030-46081052 ACAAGATAACTGGCCAATTGTGG - Intergenic
1166905701 19:46107028-46107050 ATAAGGTAACTGGGCAAGTGGGG + Intergenic
1167082610 19:47287495-47287517 AGAATATTTCTGGCCAGGTGTGG + Intergenic
1167670010 19:50846100-50846122 ATGAGATTACAGGCCGGGTGTGG + Intergenic
1167877954 19:52429883-52429905 AAAAGACTATTGGCCAAGTACGG - Intronic
1168235346 19:55059514-55059536 ATGAGATTCCCGGCCAGGTGAGG + Intronic
1168342727 19:55635099-55635121 TTAAGAGTCCTGCCCAAGTGAGG + Intronic
925088358 2:1131938-1131960 AAAGGATTAGTGGCCAGGTGCGG - Intronic
926028324 2:9564021-9564043 ATAAGATAAATGGCCAGGTGCGG - Intergenic
926902614 2:17771051-17771073 ATAAAGTTGCTGGCCTAGTGTGG - Intronic
926952914 2:18263376-18263398 ATTAAATTAGGGGCCAAGTGTGG + Intronic
927389554 2:22580016-22580038 AGAAGAATGCTGGCCAAGTGAGG + Intergenic
928440349 2:31286953-31286975 ATAAGATTCCTAGCCAGGCGCGG - Intergenic
928555409 2:32418790-32418812 ATAAAAGTATTGGCCAGGTGTGG + Intronic
928560919 2:32484261-32484283 AAAAAATTACTGGCCAGGTGCGG + Intronic
929704645 2:44197407-44197429 TTAACATTAGTGGCCAAGTGTGG - Intronic
930131582 2:47857409-47857431 ATAAAATTTCTGGCCAGGTGTGG - Intronic
930139373 2:47935934-47935956 AGAAGATAAGTGGCCAGGTGCGG - Intergenic
930176406 2:48305478-48305500 CTAAGATTCATGGCCAGGTGCGG - Intergenic
930209115 2:48616557-48616579 AGAAGAGTTGTGGCCAAGTGCGG + Intronic
930798145 2:55414773-55414795 ATAAGGTTCCTGGCCAGGTGTGG + Intronic
930829336 2:55726368-55726390 AAAAGTTTACTGGCCGGGTGCGG - Intergenic
931209447 2:60178732-60178754 AAGAGATTTCTGGCCAAGAGAGG + Intergenic
931355289 2:61532545-61532567 AAAAGATTTCTGGCCAGGCGCGG + Intronic
931753955 2:65355424-65355446 ATAAAATTTATGGCCAAGTGTGG + Intronic
932534661 2:72580431-72580453 ACAAGATTCCTGGCCGGGTGTGG - Intronic
932558255 2:72844290-72844312 ATTAGATTGCTGGCCAGGTGTGG - Intergenic
933350858 2:81150417-81150439 ATACCAGTACTGGCCAGGTGCGG - Intergenic
933377610 2:81499909-81499931 ATAACAATCCTGGCCAGGTGTGG - Intergenic
933422008 2:82060608-82060630 GTAAGATTAACGGCCAAATGTGG - Intergenic
935977968 2:108597980-108598002 ATAGCATTTCTGGCCAGGTGTGG - Intronic
936135584 2:109890574-109890596 ATAGCATTTCTGGCCAGGTGTGG - Intergenic
936209113 2:110480911-110480933 ATAGCATTTCTGGCCAGGTGTGG + Intergenic
937255012 2:120549128-120549150 CTATGATTGTTGGCCAAGTGTGG + Intergenic
937290983 2:120781590-120781612 AGAACATTACCGGCCAGGTGCGG + Intronic
937448579 2:121980320-121980342 ATAATAATTATGGCCAAGTGGGG - Intergenic
937819497 2:126293397-126293419 AAAATATTACTGGCCAGGTGTGG + Intergenic
937944775 2:127322883-127322905 AAAAAATTACTGGCCAGGTGCGG - Intronic
939171255 2:138699138-138699160 ATTATATTATTGTCCAAGTGGGG - Intronic
939710721 2:145516033-145516055 ATAACACTACAGGCCAGGTGTGG - Intergenic
940585007 2:155636526-155636548 AAAAGATTAGAGGCCAGGTGTGG - Intergenic
940722061 2:157292990-157293012 AAAAGATTCCTGGCCGGGTGTGG - Intronic
941214301 2:162686465-162686487 ATACCATTACTTGCCAAGTTTGG - Intronic
942495217 2:176532949-176532971 AAAAGAATAATGGCCAAGTTAGG - Intergenic
944048113 2:195437324-195437346 AGAATATTACAGGCCAGGTGTGG + Intergenic
946677723 2:222180211-222180233 ATAACATTACTGGCCAGGCATGG + Intergenic
946695341 2:222352011-222352033 ATAAAAATCATGGCCAAGTGGGG - Intergenic
946936369 2:224725123-224725145 ATAGAACTACTGGCCAGGTGTGG - Intergenic
947144672 2:227053834-227053856 AAAAGTTTTCTGGCCAGGTGTGG - Intronic
1168839401 20:899590-899612 ATAAGGGTACTGGGCAGGTGGGG - Intronic
1169036536 20:2457506-2457528 ATAAGAGTACTGGCCAGGCATGG + Intergenic
1169444757 20:5662145-5662167 AAAAAATTACTGGCCAGGCGTGG + Intergenic
1170657529 20:18303335-18303357 TTAAGTTTTCTGGCCAGGTGCGG - Intronic
1170867519 20:20172606-20172628 AAAAGTTTATTGGCCAGGTGTGG - Intronic
1171723546 20:28592429-28592451 TTAAGATTACTGGCCAGGTGCGG - Intergenic
1171754511 20:29090634-29090656 TTAAGATTACTGGCTGGGTGTGG + Intergenic
1171788144 20:29491919-29491941 TTAAGATTACTGGCTGGGTGCGG - Intergenic
1171859803 20:30387499-30387521 TTAAGATTACTGGCCGGGCGCGG + Intronic
1173444721 20:43107078-43107100 TTAAAAATACTGGCCAGGTGCGG - Intronic
1173477552 20:43372094-43372116 ATAAAACTACTGGCCGGGTGTGG - Intergenic
1174144000 20:48438053-48438075 AAAAGAATTCTGGCCAGGTGTGG - Intergenic
1174255419 20:49250997-49251019 ATAAGAATTCTGGCCAGGCGCGG - Intronic
1175147448 20:56907619-56907641 CCAAGATTACAGGTCAAGTGTGG - Intergenic
1176948887 21:15019776-15019798 ATAAATTTAATGGCCAGGTGTGG - Intronic
1177306657 21:19327189-19327211 ATACGAAAACTGGCCGAGTGTGG - Intergenic
1178254570 21:31040567-31040589 ATAAGATTAGAAGCCAGGTGTGG + Intergenic
1179215742 21:39365953-39365975 ATAAGTTTAGTGGCCAAGTTTGG - Intergenic
1179216703 21:39373284-39373306 AAAAGATTCCAGGCCAGGTGGGG - Intergenic
1179378474 21:40875561-40875583 ATAAGACTACTCAGCAAGTGAGG + Intergenic
1180411509 22:12614455-12614477 TTAAGATTACTGGCCGGGTGTGG + Intergenic
1180438292 22:15335849-15335871 TTAAGAAGACTGGCCAGGTGTGG + Intergenic
1181267292 22:21637946-21637968 AAAAAATTAGTGGCCAGGTGTGG - Intergenic
1181812204 22:25410297-25410319 GTAGGATTACAGGCCAGGTGGGG - Intergenic
1182136643 22:27910384-27910406 ATAATGTTTCTGGCCAGGTGTGG - Intronic
1182540232 22:31036038-31036060 ATAAAATTCCAGGCCAAGTGTGG + Intergenic
1183822393 22:40357049-40357071 ATACAAAAACTGGCCAAGTGTGG - Intronic
1184025931 22:41856417-41856439 AGAAAATTATTGGCCAGGTGTGG - Intronic
1184121751 22:42455262-42455284 ATAAGAACATTGGCCAGGTGCGG + Intergenic
1184588340 22:45462866-45462888 ACAAGATTCCAGGCCAGGTGTGG - Intergenic
949684941 3:6558377-6558399 ATAAGAATATAGGCCAGGTGTGG + Intergenic
951316235 3:21192171-21192193 ATAAGGGAACTGGCCAGGTGGGG + Intergenic
951901286 3:27660196-27660218 AAAAGAATACAGGCCAGGTGCGG + Intergenic
952260297 3:31733721-31733743 AAAATATTTCTGGCCAGGTGCGG + Intronic
953183698 3:40619361-40619383 AGAATCTTTCTGGCCAAGTGTGG - Intergenic
953656476 3:44858652-44858674 ATAAGGGAACTGGGCAAGTGGGG + Intronic
954047464 3:47945060-47945082 ATCAGATTGCTGGCCAGGCGCGG + Intronic
954470872 3:50693976-50693998 ACAAAATTGTTGGCCAAGTGTGG + Intronic
955079985 3:55649548-55649570 AAAAAATTATTGGCCAGGTGCGG - Intronic
955169226 3:56547008-56547030 ATGAGATTCTTGGCCAGGTGTGG + Intergenic
956229939 3:67002789-67002811 TTAAGAATACTGGCCCGGTGTGG - Intronic
957618766 3:82567813-82567835 AAAAGATTTTTGGCCAGGTGTGG + Intergenic
957675172 3:83356135-83356157 ATAAGGGAACTGGGCAAGTGGGG + Intergenic
959318058 3:104834864-104834886 TCAAGACTACTGGCCTAGTGCGG + Intergenic
959783182 3:110260723-110260745 TTAAGATCTCTGGCCAAGTTTGG + Intergenic
959954636 3:112221372-112221394 ATAAGATTACTGGATAAGGTAGG + Intronic
960686808 3:120303030-120303052 TTATTATTACTGGCCAGGTGTGG + Intergenic
961268177 3:125664790-125664812 ATGACATTACTGGCCAGGTATGG - Intergenic
962169212 3:133082942-133082964 AAAAGTTTACAGGCCAAGTATGG - Intronic
963178843 3:142332061-142332083 ATAATATAACTGGCCAGGTGTGG - Intronic
964362779 3:155915687-155915709 ACAAAATTAGTGGCCAGGTGTGG - Intronic
965919466 3:173894925-173894947 ATAAATTTATTGGCCGAGTGAGG - Intronic
966309034 3:178573297-178573319 AGAATATTTCTGGCCAGGTGTGG - Intronic
967023695 3:185545593-185545615 ATACAAATACAGGCCAAGTGCGG + Intronic
967099434 3:186204116-186204138 ATAATAGCACTGGCCAGGTGTGG + Intronic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
967469176 3:189842899-189842921 ATGATATTACTGGTCAGGTGGGG + Intronic
967748601 3:193087667-193087689 TTAAGAGTATTGGCCAGGTGCGG + Intergenic
968144918 3:196289895-196289917 ATAAAATTACTGGCCAGGTGTGG + Intronic
968663748 4:1809892-1809914 ATAGGGTTTCTGGGCAAGTGGGG - Intergenic
969971221 4:11050344-11050366 AGAATATTATTGGCCAAGTGAGG - Intergenic
971210490 4:24611443-24611465 ATAACCTCACTGGCCAGGTGCGG + Intergenic
971581655 4:28348953-28348975 ATAAGATGACTGACCATGAGTGG + Intergenic
972481127 4:39497224-39497246 ATATAATTACTGGCCGGGTGTGG - Intergenic
972533982 4:39984521-39984543 TTAAAATAATTGGCCAAGTGAGG + Intergenic
972707129 4:41556033-41556055 TTAAAATTACTGGCCAGGTGTGG - Intronic
973221609 4:47732851-47732873 AGTAGATTACTGGCCAGGCGCGG - Intronic
973246201 4:48013849-48013871 ATAAGATGACTAGACAAGAGGGG - Intronic
973536831 4:51891425-51891447 ATAAGATAACTTGCCATGGGTGG + Intronic
974683086 4:65189687-65189709 AAAAGATTACTGGCTGAGCGAGG - Intergenic
974938181 4:68432858-68432880 AGAAAATTATTGGCCAGGTGCGG + Intergenic
975933803 4:79556951-79556973 ATAAGAAAACTGGGCAGGTGGGG + Intergenic
976276756 4:83286078-83286100 ATAAGAGTACTGACCATCTGAGG - Intergenic
976370342 4:84280745-84280767 AAAAGTTTTATGGCCAAGTGTGG + Intergenic
976586225 4:86800128-86800150 ATAATAATTCTGGCCAGGTGCGG - Intronic
977037266 4:91970400-91970422 TTAAGATTATTGGCCAGATGTGG + Intergenic
978134846 4:105244878-105244900 GTAAGATTTCTGGCCAGGCGCGG - Intronic
978446251 4:108782841-108782863 ATAAAATTATTGGCCAGGCGCGG - Intergenic
978783794 4:112585945-112585967 AAGATAATACTGGCCAAGTGTGG + Intronic
979246190 4:118507289-118507311 ATAAGAATTCAGGCCGAGTGTGG - Intergenic
979270966 4:118761005-118761027 ATAGAATTACCGGCCAGGTGCGG - Intronic
980049803 4:128027692-128027714 TTAAAATTACTGGCCAGGCGCGG - Intronic
980094954 4:128479865-128479887 AGTAGATTATTGGCCAGGTGTGG - Intergenic
980190642 4:129520151-129520173 ATAAGATTATTGGCTGGGTGTGG - Intergenic
980714496 4:136613014-136613036 ATAAGGGAACTGGGCAAGTGGGG - Intergenic
981021812 4:140037126-140037148 AGTAGATTACTGGGAAAGTGAGG + Intronic
982572578 4:157068725-157068747 ATAATATAACAGGCCAGGTGTGG + Intergenic
983207142 4:164922320-164922342 TTAAGATAACTGGCCAGGTGTGG - Intergenic
984375910 4:178928579-178928601 ATAAGATTATAGGCCAGGTGTGG - Intergenic
985389781 4:189482437-189482459 ATAAGAGAACTGGGCAGGTGGGG + Intergenic
985435800 4:189928590-189928612 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
985437959 4:189951197-189951219 TTAAGATTACTGGCCAGGCGCGG + Intronic
985470868 5:44804-44826 TAAAGATTACAGGCCAGGTGCGG + Intergenic
986883123 5:12200416-12200438 ATAATATTACTGGCAGCGTGCGG + Intergenic
986956631 5:13158517-13158539 TTAAGATTATTGGCCAGGCGTGG + Intergenic
988199185 5:28048376-28048398 ATAAGGGAACTGGGCAAGTGGGG - Intergenic
988582884 5:32483782-32483804 ATGGAATTACTGGCCAGGTGCGG - Intergenic
989325273 5:40186114-40186136 AATAAATTACTGGCCCAGTGCGG - Intergenic
989469861 5:41803121-41803143 ATAAAATTGCTGGCCAGGAGAGG + Exonic
989660010 5:43788842-43788864 ATAAGGGGACTGGCCAGGTGGGG - Intergenic
992406360 5:76461210-76461232 ATAAAAAAACTAGCCAAGTGTGG + Intronic
992745658 5:79817798-79817820 AAAAGATTATTGGCCAGGCGCGG - Intergenic
992844716 5:80735091-80735113 ACATGATTACCGGCCAGGTGTGG + Intronic
993192801 5:84701212-84701234 ATAAGGGAACTGGGCAAGTGGGG - Intergenic
993236166 5:85312806-85312828 AAAAAATTCCTGGCCAGGTGCGG - Intergenic
993913896 5:93718117-93718139 ATAAGAATATTGGCCAGGCGGGG - Intronic
994209347 5:97070885-97070907 AGAAGATTTATGGACAAGTGGGG + Intergenic
994295228 5:98081802-98081824 ATAAGAGAACTGGGCAGGTGGGG - Intergenic
994532458 5:100987232-100987254 ATAAGGGAACTGGGCAAGTGGGG + Intergenic
994652730 5:102549623-102549645 TTAAGAAAACTGGCCAGGTGTGG + Intergenic
994981883 5:106885874-106885896 AAAAGATAGCTGGCCAGGTGAGG + Intergenic
995635352 5:114183221-114183243 ATAAGATTTCATGCCAAGTGAGG - Intergenic
996077813 5:119218084-119218106 ACAAAATTATTGGCCAGGTGTGG + Intronic
996594799 5:125187972-125187994 AAAAGATGACTGGCCAAATCAGG + Intergenic
997548239 5:134729375-134729397 AAAAGATAACTGGCCAGGCGCGG + Intergenic
998220696 5:140276488-140276510 CTGAGAGTATTGGCCAAGTGTGG + Intronic
998371987 5:141667749-141667771 ATAATATAAGTGGCCAGGTGCGG + Intronic
998772569 5:145563101-145563123 ATAAGATCATTGGCCAAGCGTGG - Intronic
998943811 5:147315033-147315055 AGAATAGTACTGGCCCAGTGTGG - Intronic
1000747515 5:165052708-165052730 ATAAGACTTCTGGCCAGGCGTGG - Intergenic
1001725190 5:173890547-173890569 TTAAGATTATTCGCCAAATGAGG - Exonic
1002116734 5:176968081-176968103 AAATGATGACTGGCCAGGTGTGG + Intronic
1003276026 6:4653851-4653873 AGAAAATTTCTGGCCAGGTGTGG - Intergenic
1004632831 6:17438075-17438097 ATAACATTGCTGGCCAGGCGTGG + Intronic
1005115303 6:22329434-22329456 ATAAGGATATTGGCCAGGTGCGG - Intergenic
1005439167 6:25846899-25846921 ATAATATTTCCGGCCAGGTGCGG - Intronic
1005445159 6:25915292-25915314 AAATGATTACTGGCCAAGATTGG + Intronic
1006469217 6:34217254-34217276 AAAAGATTAGTGGCCAGGCGTGG + Intergenic
1006543536 6:34760266-34760288 ATAAGAAAACTAGCCAGGTGTGG - Intronic
1006971141 6:38047030-38047052 ATACGACTTCTGGCCAGGTGCGG + Intronic
1008000289 6:46352948-46352970 ATTTTATTACTTGCCAAGTGAGG + Intronic
1008683695 6:53901382-53901404 ATAAAATTATTAGCCAAGTGGGG + Intronic
1008759067 6:54832258-54832280 ATAAGATTGCTGGCCAGGCACGG - Intergenic
1009414249 6:63397623-63397645 AAAAGATTATGGGCCAGGTGTGG + Intergenic
1009890573 6:69675928-69675950 ATAAGACTACTGGCTTTGTGAGG - Exonic
1010288562 6:74108673-74108695 ATAAGATTCCAGGCCAAGTCAGG + Intergenic
1010964770 6:82192454-82192476 AGATGATTTCTGGCCAGGTGTGG + Intronic
1011061716 6:83277609-83277631 ATAAGATTTGGGGCCAGGTGTGG + Intronic
1012894087 6:104929184-104929206 TTAAGATGACTGGCCAGGTGTGG + Intergenic
1014398976 6:120963772-120963794 TTAAAAATACTGGCCAGGTGTGG - Intergenic
1015529605 6:134208200-134208222 ATAAGAATGCAGGCCAGGTGCGG - Intronic
1016002762 6:139058890-139058912 ATAACATTTGTGGCCAGGTGTGG - Intergenic
1016082070 6:139868030-139868052 TTATGATTACAGGCCAGGTGCGG - Intergenic
1017164788 6:151397742-151397764 ATAGACTTAGTGGCCAAGTGCGG + Intergenic
1017779258 6:157703630-157703652 ATAAGGTAACTGGGCAGGTGGGG + Intronic
1017833070 6:158149452-158149474 ATAAGATTGCTCTCCAAGTCAGG + Intronic
1018311711 6:162516459-162516481 AAAACATTTCTGGCCAGGTGTGG + Intronic
1018428618 6:163705396-163705418 AAAAAATTGCTGGCCAGGTGCGG - Intergenic
1018480575 6:164185455-164185477 ATAACTTTAGGGGCCAAGTGTGG + Intergenic
1019141331 6:169946085-169946107 ATAAGAAAAATGGCCAGGTGTGG - Intergenic
1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG + Intergenic
1020448350 7:8293859-8293881 GTAAGATTTTTGGCCAGGTGTGG + Intergenic
1020561195 7:9729726-9729748 AAAATATTTCTGGCCAGGTGTGG + Intergenic
1021098849 7:16565151-16565173 TAAAGATTACTGGCCAGGTGCGG + Intronic
1021128485 7:16881943-16881965 ACAAGAGCACTGGCCAAGTCAGG - Exonic
1021459793 7:20873312-20873334 ATAACATTACTAGCTAAGAGAGG - Intergenic
1022024298 7:26431486-26431508 ATGTAATTACTGGCCAGGTGTGG + Intergenic
1022060417 7:26787615-26787637 AAAAGCTTCCTGGCCAGGTGTGG - Intronic
1022198217 7:28090398-28090420 ATAAGATGAATGGGCAAGTTAGG - Intronic
1022930529 7:35107818-35107840 AGAAGATTTCGGGACAAGTGGGG - Intergenic
1023340010 7:39210142-39210164 ATAAAATCACTGGAGAAGTGGGG - Intronic
1023917591 7:44601701-44601723 ATAACAATATTGGCCAGGTGCGG + Intergenic
1025823400 7:64992200-64992222 AATAAATTACTGGCCAAGGGAGG + Exonic
1026131505 7:67625021-67625043 AAAAGATTATTAGCCAGGTGTGG + Intergenic
1026403368 7:70039047-70039069 ATAAGAAACCTGGCCAGGTGTGG - Intronic
1026748729 7:73032968-73032990 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1026752377 7:73061113-73061135 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1026756028 7:73089240-73089262 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027034925 7:74918234-74918256 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027091377 7:75304189-75304211 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1027095021 7:75332160-75332182 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1027131816 7:75596674-75596696 AGAAGATTTCAGGCCAGGTGTGG - Intronic
1027310626 7:76950702-76950724 ATAAGATTTTTGGCCAGGCGTGG - Intergenic
1027324318 7:77035514-77035536 ATAAGAAAAGTGGCCAGGTGTGG - Intergenic
1027348619 7:77287909-77287931 CTAAGATCACTGGATAAGTGAGG - Intronic
1027467151 7:78529805-78529827 TTAAGATGATTGGCCAGGTGTGG - Intronic
1028328527 7:89558792-89558814 ATAATATTCCTGGCCAGGCGCGG - Intergenic
1028571997 7:92300097-92300119 TAAAAATTACTGGCCAGGTGTGG - Intronic
1029022310 7:97377745-97377767 ATAAGTCTTCGGGCCAAGTGTGG - Intergenic
1029395130 7:100302896-100302918 ATAAGAAAAGTGGCCAGGTGTGG + Intergenic
1030127627 7:106169406-106169428 ATATAATTACTGGCCAGGCGTGG + Intergenic
1031535307 7:122926712-122926734 ATCAAATTACAGGCCAGGTGTGG - Intergenic
1033314295 7:140284955-140284977 ATAAAAATACAGGCCAGGTGCGG + Intergenic
1033934878 7:146572007-146572029 AAAAGATTTTTGGCCAGGTGCGG - Intronic
1034187761 7:149192108-149192130 ATAATGTTAGTGGCCAGGTGCGG + Intergenic
1035876392 8:3194611-3194633 AAAAAATTATTAGCCAAGTGTGG - Intronic
1036555348 8:9854881-9854903 AGAAGAAAACGGGCCAAGTGTGG + Intergenic
1037341637 8:17851925-17851947 AGAACATTTCTGGCCAGGTGTGG - Intergenic
1037851966 8:22338398-22338420 AAAACATTAATGGCCAGGTGGGG + Intronic
1038184529 8:25260949-25260971 ATAAAATAACTAGCCAGGTGAGG - Intronic
1038481763 8:27906853-27906875 ATAAAATAATTAGCCAAGTGTGG - Intronic
1039179113 8:34844090-34844112 GTAAGATTAATTGCCAAATGAGG + Intergenic
1039458175 8:37721773-37721795 AGAAGATTCTTGGCCAGGTGCGG - Intergenic
1039534342 8:38294685-38294707 ATATCATCTCTGGCCAAGTGTGG + Intronic
1039719292 8:40144623-40144645 ATAAAAGAACAGGCCAAGTGTGG - Intergenic
1041061161 8:54035907-54035929 AAAAGAATGCTGGCCAAGTGCGG - Intergenic
1041442956 8:57918367-57918389 AAAAGATAAGTGGCCAGGTGCGG + Intergenic
1041715221 8:60926113-60926135 ATATCAACACTGGCCAAGTGCGG - Intergenic
1043685155 8:83075162-83075184 AAATTATTACTGGCCAGGTGTGG - Intergenic
1044483643 8:92723711-92723733 ACAAGATTCCAGGGCAAGTGTGG + Intergenic
1045656305 8:104390787-104390809 ATTAGAGAACTGGCCAGGTGTGG - Intronic
1046534259 8:115488398-115488420 ATAAGACTACCGGCCAGGTGAGG + Intronic
1049111663 8:140648904-140648926 AAAAAATTACAGGCCAGGTGCGG + Intergenic
1050541707 9:6675947-6675969 ACAAGAGCACAGGCCAAGTGTGG - Intergenic
1051055447 9:12979551-12979573 ATGAAAATGCTGGCCAAGTGCGG - Intergenic
1051073646 9:13204295-13204317 ATAATGCTACTGGCCAGGTGTGG + Intronic
1051785221 9:20734798-20734820 ATACAAAAACTGGCCAAGTGTGG - Intronic
1052545970 9:29880349-29880371 ACAGGATTACTGGACAAGTAAGG + Intergenic
1052922121 9:33979590-33979612 AAAAAATAACTGGCCAGGTGCGG + Intronic
1053155270 9:35773957-35773979 ATAATAATACGGGCCAGGTGTGG - Intergenic
1053169204 9:35866789-35866811 ATAAGATTCCTGGCCAGGCATGG + Intergenic
1054862608 9:69969110-69969132 ATAATATTATAGGCCAGGTGCGG + Intergenic
1057521163 9:95761732-95761754 ATAAGAATACTAGTCAGGTGTGG - Intergenic
1058109800 9:101019481-101019503 ATAGCATTACTGGCCAAAAGGGG + Intergenic
1059083667 9:111276347-111276369 ATAAGATTCATGGCCAGGTGTGG - Intergenic
1059100317 9:111465241-111465263 ATAAGATTACTCTCCAAGGCCGG + Intronic
1059124125 9:111667518-111667540 AAGAAATTACTGGCCAGGTGTGG - Intronic
1059912287 9:119058412-119058434 ATGAGATCTCTGGCCCAGTGCGG + Intergenic
1060728156 9:126019605-126019627 CTAATAATACTGGCCCAGTGCGG + Intergenic
1060950174 9:127596580-127596602 ATAATAATAATGGCCATGTGCGG - Intergenic
1061335078 9:129927911-129927933 ATAAAACTATTGGCCAGGTGTGG - Intronic
1061336029 9:129936877-129936899 ATAAAACTAATGGCCAGGTGCGG + Intronic
1061586562 9:131573302-131573324 ATAAAAATAATGGCCAGGTGCGG + Intergenic
1202803955 9_KI270720v1_random:32317-32339 TTAAGATTACTGGCCGGGTGCGG - Intergenic
1203448755 Un_GL000219v1:89359-89381 TTAAGATTACTGGCCGGGAGCGG - Intergenic
1186169476 X:6861721-6861743 AGAAGCTCACTGGGCAAGTGGGG + Intergenic
1186429362 X:9491287-9491309 ATAAATATACTGGCCAAGTGCGG - Intronic
1186483847 X:9917811-9917833 ATAACAATATTGGCCAGGTGTGG - Intronic
1187382177 X:18813028-18813050 TTAAGAAAACAGGCCAAGTGCGG - Intronic
1188374769 X:29414426-29414448 TTAAAATTATTTGCCAAGTGTGG + Intronic
1189291623 X:39890020-39890042 AGAGGATTACTGGCCAGGGGTGG + Intergenic
1189343895 X:40225769-40225791 ATCATATTCCTGGCCAGGTGTGG + Intergenic
1189413973 X:40798140-40798162 AAAAGAAAACTGGCCAGGTGTGG + Intergenic
1189470368 X:41309161-41309183 TTAACATCACTGGCCAAGTCGGG - Intergenic
1189682548 X:43531817-43531839 ATAAGATTCCTGTCCTAGTTAGG + Intergenic
1189826794 X:44926905-44926927 ACACAATTACTGGCCAAGTAAGG - Intronic
1190028303 X:46946909-46946931 ACAAGATTACATCCCAAGTGTGG + Intronic
1190041707 X:47077619-47077641 AAAACAAAACTGGCCAAGTGTGG - Intergenic
1190261296 X:48799134-48799156 AAAAAATTACTGGCCAGGCGTGG - Intergenic
1191825633 X:65362437-65362459 ATAAGGGAACTGGGCAAGTGGGG - Intergenic
1192096276 X:68214704-68214726 ATAAGACTGTAGGCCAAGTGCGG + Intronic
1192443087 X:71189544-71189566 ATAACCTTACTGGCCGGGTGTGG + Intergenic
1193540565 X:82766807-82766829 ATAAAATAATTGGCCAGGTGTGG - Intergenic
1194956337 X:100185321-100185343 AAAAGCTTACAGTCCAAGTGAGG - Intergenic
1195110231 X:101640681-101640703 AAAATATTTCTGGCCAGGTGCGG - Intergenic
1195131052 X:101852677-101852699 AAAAGATTATAGGCCAGGTGTGG + Intronic
1195857664 X:109348455-109348477 ATATGATTACTTGCCGGGTGCGG + Intergenic
1196699828 X:118655997-118656019 AAAAGATTCTTGGCCGAGTGTGG + Intronic
1197541638 X:127770307-127770329 ATAAGGATAGTGGCCAGGTGCGG + Intergenic
1198465771 X:136903454-136903476 ATCAGACTATTGGCCAGGTGCGG - Intergenic
1198511534 X:137356667-137356689 ATAAGATTACAGGCCACTGGGGG + Intergenic
1198631563 X:138644568-138644590 CAAAGATTCCTGGCCAGGTGCGG - Intronic
1198960925 X:142182327-142182349 TTAAGATTCCTGGCCAGGCGCGG - Intergenic
1199365347 X:146973549-146973571 TTAAGATTAAAGGCCAGGTGTGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201388807 Y:13473957-13473979 AGATGATTACTGGCCGGGTGTGG + Intronic