ID: 1148519160

View in Genome Browser
Species Human (GRCh38)
Location 17:48253226-48253248
Sequence GAGTCCCCTCTAAGATTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148519160 Original CRISPR GAGTCCCCTCTAAGATTCCA GGG Intronic
902691600 1:18113335-18113357 GACCCCCGGCTAAGATTCCATGG + Intronic
903442390 1:23397842-23397864 GAGTCCCCTGTGAGATAGCAGGG + Exonic
907423467 1:54363163-54363185 GAGTCACATCTCAGTTTCCAAGG + Intronic
908770763 1:67593547-67593569 GAGACCCCTCTAGGAGGCCAAGG - Intergenic
908776589 1:67646850-67646872 GAGTCCCCTCAATGAGTCAATGG - Intergenic
910023668 1:82623307-82623329 AAGTCCCTTCTAAGATTTAAGGG + Intergenic
917293467 1:173494516-173494538 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
918589441 1:186223856-186223878 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
1067708339 10:48627696-48627718 CAGTCTCCTCTGATATTCCAAGG + Intronic
1073117629 10:101100603-101100625 CATTCCCCACTAAGATCCCAGGG + Intronic
1076206614 10:128609354-128609376 GAGACACCTCAAAGATTTCAAGG - Intergenic
1077248322 11:1549668-1549690 TAGGCCCCTCAAAGACTCCATGG + Intergenic
1077506337 11:2931510-2931532 GCGTGCCCTCGAAGATTCCAAGG + Intergenic
1079412413 11:20201476-20201498 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
1079785650 11:24668286-24668308 GAGTTTCATCGAAGATTCCAGGG + Intronic
1080288223 11:30640845-30640867 GAGTCCTCTGTAAGATTCTGGGG + Intergenic
1080921731 11:36715959-36715981 GAGTCCCTTCTAAGGGTCCTTGG + Intergenic
1084591266 11:70092044-70092066 GCGCTCCCTCTAAGACTCCAGGG + Intronic
1105764463 13:23545644-23545666 CAGTCCACCCTAAGATACCAAGG - Intergenic
1107008703 13:35645606-35645628 GAGTTCTCTCTAAAATTTCAGGG + Intronic
1107519501 13:41165240-41165262 GTGTCACATCTAAGACTCCATGG + Intergenic
1109443023 13:62399167-62399189 GAGTCCCGTCTAAGATTTAGGGG + Intergenic
1110267275 13:73552630-73552652 GTGTCCCCTCTTAGAGGCCACGG + Intergenic
1110447599 13:75604065-75604087 CAGCCCCTTCTACGATTCCATGG - Intronic
1111077184 13:83252445-83252467 GAGTCCCCCCAAAAATTCAAAGG + Intergenic
1112593012 13:100781743-100781765 TATTCCCCTCTAGGTTTCCAAGG - Intergenic
1115129932 14:30042815-30042837 GAGACCCTTCTAAGATTTAAGGG + Intronic
1115481877 14:33868605-33868627 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
1118118338 14:62806754-62806776 GAGTCCCTTCTAAGATTTAGGGG + Intronic
1118610272 14:67533893-67533915 GAGTCCTCGCTAAGACTCCTAGG - Intronic
1121853594 14:97246345-97246367 GAGTCACCTCTCGGATGCCAGGG - Intergenic
1127113700 15:55702283-55702305 GAGACCCCTTTAATATTCCCAGG + Intronic
1128148864 15:65348708-65348730 GAGTCCCTTCTAAGATTTTAGGG + Intronic
1131720492 15:95163235-95163257 AAGTCCCTTGTAAAATTCCATGG - Intergenic
1141700366 16:85639473-85639495 GACTCCCCTCTAAGCCTCCTGGG + Intronic
1143702052 17:8667780-8667802 GTTTCCCCTCCAAGAGTCCAAGG + Intergenic
1145114736 17:20198652-20198674 GAGTCCCTTCTAAGATTTAGGGG - Intronic
1147863008 17:43534592-43534614 GAGTGCCCTGGAAAATTCCAGGG + Intronic
1148519160 17:48253226-48253248 GAGTCCCCTCTAAGATTCCAGGG + Intronic
1155850700 18:30770168-30770190 GAGTCCCTTCTAAGATTTAAGGG + Intergenic
1156299038 18:35819167-35819189 GAAACCCCTTTAAAATTCCAAGG + Intergenic
1158873077 18:61707624-61707646 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
1160425869 18:78778799-78778821 AGGTCCCCACTGAGATTCCAAGG + Intergenic
1161807751 19:6454789-6454811 GAGTCTCCTCTATGAATCCTAGG + Intronic
1161851440 19:6739850-6739872 GAGCCCCCTCTAAGATACATTGG - Intronic
1163800093 19:19359398-19359420 TGGTCCCCTCTAAGAATGCAGGG - Intergenic
1166433986 19:42751712-42751734 GAGTCCTCTCTAAACTCCCACGG + Intronic
1168549000 19:57277933-57277955 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
927456976 2:23261400-23261422 GAGGCCCCTCTAGGATGACAAGG + Intergenic
931985234 2:67735580-67735602 TAGAGCCCCCTAAGATTCCATGG + Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
937918534 2:127113597-127113619 GAGTCACTTCTGATATTCCAGGG - Intergenic
941303690 2:163833893-163833915 GTTTCTCCTCTTAGATTCCAGGG + Intergenic
941997939 2:171619111-171619133 GAGTCCACACTAATATTGCAAGG + Intergenic
945003383 2:205376349-205376371 ACATCCCTTCTAAGATTCCATGG + Intronic
1170266522 20:14471701-14471723 GAGTGCCTTCTAAGGTTCTAAGG + Intronic
1170359661 20:15531449-15531471 GTGTCACCTCTAAGATTTAACGG + Intronic
1173840131 20:46151808-46151830 GTGTCCTCTCTAGGATTCCCTGG + Intergenic
1175159612 20:56998237-56998259 GAATTCCCTCAAAGATCCCAAGG - Intergenic
1175815507 20:61881303-61881325 GAGCCTCCTCTCAGACTCCATGG - Intronic
1177996402 21:28104892-28104914 GAGTCCCTCCTATGATGCCAAGG - Intergenic
1180048327 21:45319938-45319960 GAGTCTCCCCTAAGATTTGAAGG + Intergenic
1180658516 22:17445412-17445434 CAGTCATCTCTAAGTTTCCATGG + Intronic
1181580973 22:23827855-23827877 AAGTCCCTCCTAAGATCCCATGG - Intronic
1182543221 22:31056909-31056931 GACCCCCCTCCAACATTCCAGGG + Intergenic
952257292 3:31706371-31706393 GAGACCCTTCTAAGAATCCAAGG - Intronic
956147956 3:66211153-66211175 GAATCCCCTCTTAGAGTTCAAGG - Intronic
956369165 3:68539505-68539527 CTGTCCCCTTTAGGATTCCAAGG - Intronic
964612361 3:158627871-158627893 GAGTCCAATCTACGATTCCGTGG - Intergenic
964990248 3:162801935-162801957 GAGCCCCCTCTAAGAACTCAGGG - Intergenic
965586071 3:170319429-170319451 GAGTCCCTTCTAAGATTTAAAGG - Intergenic
969420266 4:7090397-7090419 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420275 4:7090432-7090454 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420284 4:7090467-7090489 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420293 4:7090502-7090524 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420302 4:7090537-7090559 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420311 4:7090572-7090594 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420320 4:7090607-7090629 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420328 4:7090642-7090664 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420336 4:7090677-7090699 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420344 4:7090712-7090734 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420352 4:7090747-7090769 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969420360 4:7090782-7090804 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
969504886 4:7579467-7579489 GATTCTCCCCCAAGATTCCATGG + Intronic
973581692 4:52350372-52350394 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
974051972 4:56950109-56950131 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
975043136 4:69769395-69769417 GAGTCCCTTCAAAAATTTCAGGG + Intronic
979773513 4:124559068-124559090 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
980988070 4:139715056-139715078 GAGTCCCTTCTAAGATTTAGCGG - Intronic
982206368 4:153000050-153000072 TAGTCCTTTCTACGATTCCAAGG - Intergenic
983079461 4:163367021-163367043 CAAGCCCCTCTAAAATTCCATGG - Intergenic
983105145 4:163677437-163677459 CAGTACACTCCAAGATTCCAAGG - Intronic
986418365 5:7550853-7550875 GTGTCCACTATCAGATTCCAGGG - Intronic
987166340 5:15202204-15202226 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
990830991 5:59956777-59956799 GTTTCACCTCTCAGATTCCAGGG - Intronic
1000061033 5:157655392-157655414 GAGTCCCTTCTAAGATTTAGGGG + Intronic
1001639002 5:173232304-173232326 GAGTGCCCTCCGAGAGTCCATGG - Exonic
1007353275 6:41291250-41291272 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
1014914001 6:127122416-127122438 GAGGCCCCACTAAGATTCTGTGG - Intronic
1018357555 6:163034431-163034453 GAGTGCCTTCTAAGATTCAGGGG - Intronic
1022840460 7:34159194-34159216 GTGTTCCCTCTAAGGTTCCTGGG - Intergenic
1023587914 7:41750353-41750375 GAGTCACTTCTAAAATTTCAGGG - Intergenic
1038556808 8:28525781-28525803 GAGGCCCCTCTAGAAGTCCAGGG + Intronic
1042742725 8:72068914-72068936 GAGCACCTTCTAAGCTTCCATGG - Intronic
1047633137 8:126729940-126729962 GTGTCCCCTCTAAGATTCAGGGG - Intergenic
1052663814 9:31469458-31469480 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
1053076298 9:35137606-35137628 GAGTCCCTTCTAAGATTTAAGGG - Intergenic
1054776979 9:69132115-69132137 GAGTCCCTTATAAGCTTCCCTGG - Intronic
1055684533 9:78756804-78756826 GAGTCTCCTATTAGATTGCAGGG + Intergenic
1059424997 9:114215439-114215461 GAGTTCTCTCCAGGATTCCAGGG - Intronic
1062484259 9:136766742-136766764 GAGTCCTCTCTAAGCTCCCCCGG - Intergenic
1185655039 X:1677772-1677794 GTGTCCCCTCTAAAATTCCTAGG + Intergenic
1190947404 X:55109260-55109282 GGGTCCCTTCTAAGATTCAGGGG + Intronic
1191119407 X:56887789-56887811 GAGTCCCTTCTAAGATTTAAGGG + Intergenic
1191636488 X:63383327-63383349 GAGATCCCTCAAAGATTTCAAGG - Intergenic
1192542667 X:71988459-71988481 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
1194040905 X:88941133-88941155 GAGTCCCTTCTAAGATTTAGGGG - Intergenic
1196975270 X:121151997-121152019 GAGTCCCTTCTAAGATTTAGGGG + Intergenic
1201982277 Y:19920787-19920809 GAGTCTCCACTAAGAGCCCATGG - Intergenic