ID: 1148522650

View in Genome Browser
Species Human (GRCh38)
Location 17:48295588-48295610
Sequence CTCACTGCTATGAGAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148522650_1148522653 20 Left 1148522650 17:48295588-48295610 CCAAAGCCTCTCATAGCAGTGAG 0: 1
1: 0
2: 0
3: 41
4: 535
Right 1148522653 17:48295631-48295653 TTTTCCATTTTCGCTGTTTATGG 0: 1
1: 0
2: 0
3: 15
4: 295
1148522650_1148522654 21 Left 1148522650 17:48295588-48295610 CCAAAGCCTCTCATAGCAGTGAG 0: 1
1: 0
2: 0
3: 41
4: 535
Right 1148522654 17:48295632-48295654 TTTCCATTTTCGCTGTTTATGGG 0: 1
1: 0
2: 2
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148522650 Original CRISPR CTCACTGCTATGAGAGGCTT TGG (reversed) Intronic
901498581 1:9637277-9637299 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
902057539 1:13614669-13614691 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
902545430 1:17186687-17186709 CTCTCTGCAAGGAGGGGCTTGGG - Intergenic
903116618 1:21183554-21183576 CTCAATGCTTTGGGAGGCCTAGG + Intergenic
903162434 1:21498727-21498749 ATCACTGTTGTGACAGGCTTAGG + Intergenic
903622493 1:24707945-24707967 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
904315180 1:29655354-29655376 CTCAATGCCATGAGAGGATGAGG - Intergenic
905122077 1:35690088-35690110 CTCAGTGCTGTGGGAGGCTGAGG - Intergenic
905639506 1:39579061-39579083 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
905805263 1:40872227-40872249 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
906220550 1:44075039-44075061 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
906230325 1:44157054-44157076 CCCAGTGCTTTGGGAGGCTTCGG + Intergenic
906393925 1:45443926-45443948 CTCAATGCTTTGAGAGGCCAAGG + Intronic
906490959 1:46268118-46268140 CCCAGTGCTTTGAGAGGCTGGGG + Intronic
906780246 1:48566876-48566898 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
907006874 1:50923166-50923188 CTCAATGCTTTGAGAGGCTGAGG + Intronic
907022122 1:51078156-51078178 CTCAGTGCTCTGGGAGGCTGAGG - Intergenic
907081718 1:51629696-51629718 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
907098278 1:51802035-51802057 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
907396451 1:54193722-54193744 CCCACTACTTTGAGAGGCTGAGG + Intronic
907659769 1:56381275-56381297 CTAAGTGCTATGGGAGCCTTTGG + Intergenic
907688810 1:56642179-56642201 CTCAGTACTTTGAGAGGCTGAGG + Intronic
907797240 1:57729808-57729830 CTCAGTGCTTTAAGAGGCTAAGG + Intronic
908011521 1:59783006-59783028 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
908338439 1:63151260-63151282 CTCAATGCTATGAGATGACTCGG + Intergenic
908761007 1:67511960-67511982 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
909559814 1:76997746-76997768 CTCAATGCTTTGAGAGGCCAAGG + Intronic
910315370 1:85876284-85876306 GTCACTGATTTGAGAGGATTAGG + Intronic
910386852 1:86693114-86693136 CTAACTGCTGTTAGAGGGTTTGG + Intergenic
910873701 1:91857686-91857708 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
910894045 1:92048951-92048973 CCCAGTGCTGTGAGAGGCTGAGG - Intronic
911320138 1:96403884-96403906 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
911594217 1:99782247-99782269 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
911601565 1:99853635-99853657 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
911747618 1:101457072-101457094 CTCAATGCTTTGGCAGGCTTAGG + Intergenic
911792890 1:102040847-102040869 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
912369491 1:109162925-109162947 CTCTCTGCTTTCAGAAGCTTAGG + Intronic
912790554 1:112645372-112645394 CTCAATGCTTTGGGAGGCTGAGG + Intronic
912999694 1:114567256-114567278 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
913002238 1:114592465-114592487 CCCACGGCTTTGAGAGGCTGAGG + Intronic
913257363 1:116965533-116965555 CTCACTGATTAGAGAGGCTGAGG - Intronic
915016889 1:152742755-152742777 GTCAGTGCTATGAGAAGCTGTGG - Intronic
915424855 1:155817242-155817264 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
915854092 1:159362640-159362662 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
917532360 1:175847363-175847385 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
917711233 1:177687521-177687543 CTCACTGGGATGACAAGCTTTGG - Intergenic
917711327 1:177688230-177688252 CTCACTGGGATGACAAGCTTTGG - Intergenic
918352883 1:183675893-183675915 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
918905502 1:190487337-190487359 CTCAGTGCTTTGAGAGGCAGAGG + Intergenic
919142723 1:193592959-193592981 CTCACTGCTAATAGAGGCTCTGG + Intergenic
920307087 1:205025876-205025898 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
920792000 1:209101931-209101953 CCCACTGCTTTGGGAGGCTTAGG - Intergenic
920999532 1:211029078-211029100 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
921294612 1:213690128-213690150 TCCACTGCTTTGAGAGGCTTTGG + Intergenic
921567604 1:216738964-216738986 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
922484651 1:225964025-225964047 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
922498109 1:226076534-226076556 CTCACGCCTATAAGAGGCTGAGG + Intergenic
923168124 1:231387107-231387129 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
923202749 1:231727834-231727856 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
923700612 1:236296650-236296672 CTCAGTGCTGTGGGAGGCTGAGG + Intergenic
924231394 1:241964944-241964966 CTCAGCCCTTTGAGAGGCTTAGG - Intergenic
924253657 1:242160269-242160291 CCCAATGCTTTGAGAGGCTGAGG - Intronic
1063391841 10:5654844-5654866 CTCACCACTTTGAGAGGCTGAGG + Intronic
1063872304 10:10431253-10431275 CCCAGTGCTTTGGGAGGCTTAGG + Intergenic
1064706538 10:18078198-18078220 CCCACTGCTTTGGGAGGCTAAGG + Intergenic
1065197631 10:23282510-23282532 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1065593385 10:27288482-27288504 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1065656983 10:27961812-27961834 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1065773620 10:29100134-29100156 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1065930522 10:30474689-30474711 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1065960403 10:30729588-30729610 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1066098203 10:32093140-32093162 CCCACTGCTTTGGGAGGCCTAGG - Intergenic
1066310253 10:34189079-34189101 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1066418608 10:35243701-35243723 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
1067815042 10:49467817-49467839 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1072454851 10:95566908-95566930 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1072976296 10:100061954-100061976 CTCAGCGCTTTGAGAGGCTGAGG - Intronic
1073331812 10:102674856-102674878 CTGCCTGCTAGGAGAGGCCTTGG + Exonic
1073620624 10:105044116-105044138 CTCAGTACTTTGAGAGGCTGAGG + Intronic
1074160795 10:110834911-110834933 CTCACTGCTATGACTGGCCTCGG - Intronic
1074676943 10:115861851-115861873 CTCAGTGCTTTGAGAGGCCAAGG + Intronic
1075215539 10:120529594-120529616 CTCAGTGCCATGGGAGGCTGAGG + Intronic
1075327671 10:121547645-121547667 CCCACTGCTTTGGGAGGCTGAGG - Intronic
1075335134 10:121603309-121603331 CTCAGTGCTTTGGGAGGCTAAGG - Intergenic
1077070852 11:671470-671492 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
1077764297 11:5141339-5141361 CTCAATGCTTTGGGAGGCTGAGG + Intergenic
1078375234 11:10787775-10787797 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
1080632221 11:34088408-34088430 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1080823145 11:35826050-35826072 ATCAGTGCTTTGAGAGGCTCAGG - Intergenic
1081120071 11:39255508-39255530 CTCACTGCTCTGTGAAACTTTGG - Intergenic
1081136948 11:39450481-39450503 CTCCCTGCTATGTGCGGCTTCGG - Intergenic
1081625131 11:44650552-44650574 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1084250153 11:67891775-67891797 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
1084670947 11:70606299-70606321 CCCAATGCTATGGGAGGCTGAGG + Intronic
1084822636 11:71703568-71703590 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
1084921733 11:72476283-72476305 CCCACGGCTGTGAGAGGCCTAGG - Intergenic
1085511429 11:77090220-77090242 CCCACTGCCAGGAGAGGCTCAGG - Intronic
1085602052 11:77863763-77863785 CTCAGTGCTTTGAGGGGCTGAGG - Intronic
1086169307 11:83817622-83817644 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1086871503 11:92042891-92042913 CTCAGTGCTTTGGGAGGCTGCGG + Intergenic
1086885524 11:92201008-92201030 CTCAATGCTTTGGGAGGCTGGGG - Intergenic
1087380857 11:97403044-97403066 CTCAATGCTTTGAGAGGTTGGGG - Intergenic
1087898963 11:103619093-103619115 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1088684446 11:112273224-112273246 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1089283407 11:117390395-117390417 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1090167020 11:124560229-124560251 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1090653654 11:128826421-128826443 CCCAATGCTTTGAGAGGCTGAGG + Intergenic
1091265615 11:134269067-134269089 CTCAGTGCTTTGAGAGGCCTAGG + Intergenic
1091950403 12:4588173-4588195 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1092420479 12:8327295-8327317 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
1092944339 12:13439056-13439078 CCCACTGCTCTGTGAAGCTTTGG - Intergenic
1093464380 12:19435241-19435263 CACACAGCTATGGGAGGCTGAGG - Intronic
1093892109 12:24534747-24534769 CCCACTCCTAGGAGAGGCTTTGG - Intergenic
1094501833 12:31028477-31028499 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1095258793 12:40074415-40074437 CCCAATGCTATGGGAGGCTGAGG - Intronic
1097290647 12:57911650-57911672 CTGAGTACTATGAGAGTCTTTGG - Intergenic
1097518880 12:60643764-60643786 CTAACTGCTATTAGAGGTGTTGG + Intergenic
1097810367 12:64012666-64012688 GTCCCAGCTATGAGAGGCTGAGG - Intronic
1097937061 12:65264567-65264589 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
1099103522 12:78472938-78472960 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1100305644 12:93347666-93347688 CTCACCACTTTGAGAGGCTGAGG + Intergenic
1101245710 12:102882696-102882718 CTCTCTGCTATGATAAGCTAAGG - Intronic
1101881129 12:108626749-108626771 CTCAGTGCTTTGAGAGGCCGAGG - Intronic
1101905402 12:108821127-108821149 CCCAATGCTTTGAGAGGCTGAGG + Intronic
1102021554 12:109686858-109686880 CCCACTGCTTTGGGAGGCTGAGG + Intergenic
1102281017 12:111618997-111619019 CTCAGTGCTTTGAGAGGCTAAGG + Intergenic
1102381283 12:112468811-112468833 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1102500314 12:113347608-113347630 CTCAGTGCTATGGAAGGCCTAGG + Intronic
1102555357 12:113723251-113723273 CTCAGTGCTTTTAGAGGCTGAGG + Intergenic
1102674995 12:114651524-114651546 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1103644290 12:122378742-122378764 CCCACTTCTTTGAGAGGCTGAGG + Intronic
1104850459 12:131870916-131870938 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1105040873 12:132959991-132960013 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1105056004 12:133099570-133099592 CTCAGTACTTTGGGAGGCTTGGG + Intronic
1105350107 13:19607309-19607331 CACAGTGCTTTGAGAGGCTCAGG - Intergenic
1105391274 13:19981019-19981041 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1105784449 13:23734771-23734793 CTAACTGCTGTTAGAGGTTTGGG - Intronic
1106116737 13:26824231-26824253 CTCAGTCCTTTGAGAGGCTGAGG - Intergenic
1106288268 13:28336996-28337018 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1106562283 13:30857116-30857138 CTCACATCTCTGAGAGGGTTTGG + Intergenic
1106997655 13:35506317-35506339 CTCAGTTCTATGAGAGGCCAAGG - Intronic
1107501008 13:40975879-40975901 CTCAGTGATATTAAAGGCTTTGG + Intronic
1108044394 13:46369463-46369485 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
1108285153 13:48899258-48899280 CCCAGTGCTTTGGGAGGCTTAGG - Intergenic
1108397972 13:50008413-50008435 CTCAGTGCTTTGCGAGGCTGAGG + Intronic
1109640070 13:65180100-65180122 CTCAGTGCTCTGTGAGGCTGAGG - Intergenic
1110218537 13:73049464-73049486 CTTAATGCTTTGAGAGGCTGAGG - Intergenic
1111353457 13:87064162-87064184 CCCACTGCTTTGAGAAGCTGAGG - Intergenic
1111530266 13:89527413-89527435 CTCAGTGCTATGGGAGGCCAAGG - Intergenic
1112008684 13:95276161-95276183 CTCACTGCTTTGAGGGGCCAAGG + Intronic
1112306840 13:98282052-98282074 CTCAATGCTTTGGGAGGCCTAGG + Intronic
1112660746 13:101504765-101504787 CTCACTGCTATGACTTGCTTTGG + Intronic
1115358591 14:32476338-32476360 CTTACTGAGTTGAGAGGCTTGGG + Intronic
1115553293 14:34523787-34523809 CCCAGTGCTATGGGAGGCTAAGG - Intronic
1115632399 14:35258240-35258262 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1116245848 14:42411003-42411025 CTCACTACTTTGGGAGGCTGAGG - Intergenic
1116909779 14:50448263-50448285 CTCAGTACTATGGGAGGCTGAGG - Intronic
1118194120 14:63608851-63608873 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1119881470 14:78103307-78103329 CTCACTGCCTTTAGAGGCTCAGG - Intergenic
1120541632 14:85758600-85758622 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1121544894 14:94756026-94756048 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
1123712772 15:23001591-23001613 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1124426583 15:29568439-29568461 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1124803632 15:32859784-32859806 CCCAGTGCTTTGAGAGGCCTTGG + Intronic
1124963566 15:34416547-34416569 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1124980185 15:34562773-34562795 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1126014832 15:44340506-44340528 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1126133103 15:45363030-45363052 CCCAATGCTATGGGAGGCATAGG + Intronic
1126309375 15:47298542-47298564 ATGACTTCTATGAAAGGCTTGGG - Intronic
1126782692 15:52151853-52151875 CTCAGTGCTTTCAGAGGCTGAGG + Intronic
1127739128 15:61881608-61881630 CTCACATCAATGAAAGGCTTGGG + Exonic
1128012966 15:64316140-64316162 CCCAGTGCTTTGAGAGGCTGGGG - Intronic
1128937234 15:71757246-71757268 GTCACAGCTATGAGGGGATTGGG - Intronic
1129777809 15:78248267-78248289 CTCATTCCTATGAGACCCTTAGG - Intergenic
1132015276 15:98309734-98309756 CTCACTGCTTTGGGAGGCAGAGG - Intergenic
1133323780 16:4931111-4931133 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1133374995 16:5277717-5277739 CTCACTTATATGAGCAGCTTAGG - Intergenic
1134009616 16:10842220-10842242 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
1134175891 16:12006086-12006108 CTCATTGCTTTGGGAGGCTGAGG + Intronic
1134239368 16:12494095-12494117 CCCAGTGCTATGCGAGGCTCAGG + Intronic
1135643037 16:24137437-24137459 CCCACTGCTTTGGGAGGCTGAGG - Intronic
1135664062 16:24320981-24321003 CTCAGTGCTTTGGGAGGCTCAGG - Intronic
1135700655 16:24629726-24629748 CTCACTGCTTTGGGAGGCCGAGG + Intergenic
1135767922 16:25193893-25193915 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1136180880 16:28551052-28551074 CCCACTGCTTTGGGAGGCTGAGG - Intergenic
1136588704 16:31203985-31204007 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1137979695 16:53059089-53059111 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1138586221 16:57971957-57971979 CCCAATACTATGAGAGGCTGAGG - Intergenic
1138665138 16:58560626-58560648 CTCACTGCTTTGAAAGGCTGAGG + Intronic
1139397994 16:66655865-66655887 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1140433560 16:74925776-74925798 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1141375597 16:83527197-83527219 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1142526734 17:547878-547900 CTCACTCCTTTGGGAGGCTGAGG - Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143711401 17:8738074-8738096 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1143905261 17:10203324-10203346 CCCAATGCTTTGAGAGGCTGAGG + Intergenic
1144035576 17:11362388-11362410 CTCAATGCTTTGGGAGGCTGAGG - Intronic
1144508994 17:15859072-15859094 CTCAGTGCTTTGGGAGGCTTAGG - Intergenic
1144648961 17:16995194-16995216 CTAAGTGCTTTGAGAGGCTGAGG + Intergenic
1144838154 17:18168654-18168676 CCCACTGCTTTGGGAGGCTGAGG - Intronic
1145073320 17:19830450-19830472 CTTAGTGCTTTGAGAGGCTGAGG - Intronic
1145111691 17:20169121-20169143 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1145173111 17:20676712-20676734 CTCAGTGCTTTGGGAGGCTTAGG - Intergenic
1145219561 17:21076972-21076994 CCCACTGCTTTGAGAGGCTGAGG + Intergenic
1145869470 17:28261675-28261697 ATCACAGCTATGGGAGGCTGAGG - Intergenic
1145908288 17:28528246-28528268 CTCTCTGCCATGAGGGGCCTGGG + Intronic
1146173105 17:30647894-30647916 CCCACTGCTTTGAGAGGCCTAGG + Intergenic
1146346565 17:32063927-32063949 CCCACTGCTTTGAGAGGCCTAGG + Intergenic
1146775780 17:35614438-35614460 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1146862048 17:36311600-36311622 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1147092376 17:38115703-38115725 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
1147131015 17:38408997-38409019 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1147169952 17:38612275-38612297 CCCAGTGCTATGAGAGGCCAAGG + Intergenic
1147181439 17:38688499-38688521 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1147238241 17:39073275-39073297 CCCAGTGCTCTGAGAGGCTGAGG - Intronic
1147735083 17:42631695-42631717 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1147764232 17:42822929-42822951 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1147891940 17:43723442-43723464 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1148373221 17:47116679-47116701 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1148424667 17:47583662-47583684 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1148522650 17:48295588-48295610 CTCACTGCTATGAGAGGCTTTGG - Intronic
1148802053 17:50234760-50234782 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1149970399 17:61212351-61212373 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151145070 17:72032795-72032817 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1151555416 17:74844122-74844144 CTCAACACTTTGAGAGGCTTAGG - Intronic
1151949166 17:77339758-77339780 CCCAATGCTTTGAGAGGCTGAGG - Intronic
1152960436 18:76611-76633 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1153572986 18:6492074-6492096 CTCAGTGCTCTGGGAGGCCTAGG - Intergenic
1153866438 18:9273788-9273810 CTCAATGCTCTGGGAGGCTAAGG - Intronic
1153876424 18:9376589-9376611 CTCACCCCTTTGAGAGGCTGAGG + Intronic
1153884475 18:9451133-9451155 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1154224993 18:12495183-12495205 TACACTGTTTTGAGAGGCTTTGG + Intronic
1154408528 18:14119704-14119726 CTCAGTGCTTTCAGAGGCTGAGG - Intronic
1154959028 18:21289297-21289319 CTCAATGCTTTGGGAGGCTGAGG + Intronic
1155139877 18:23035429-23035451 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1155296734 18:24391470-24391492 CCCACTGCTTTGGGAGGCTGAGG + Intronic
1155536260 18:26821356-26821378 CCCACTGCTGTGGGAGGCTGAGG + Intergenic
1156558000 18:38089226-38089248 CTAACTGCTTTGAGTGCCTTTGG - Intergenic
1157789630 18:50520175-50520197 CTTACTATTAGGAGAGGCTTTGG + Intergenic
1161065920 19:2237165-2237187 CTCACTGCTCAGGGAGGCCTTGG + Intronic
1161239505 19:3214235-3214257 CCCACAGCTTTGAGAGGCTGAGG - Intergenic
1161599338 19:5171442-5171464 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1161955689 19:7493619-7493641 CCCAGTGCTATGGGAGGCTGAGG - Intronic
1162022786 19:7875227-7875249 CCCACTGCTTTGGGAGGCTGAGG + Intergenic
1162055934 19:8064083-8064105 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1162189333 19:8932469-8932491 CTCACAGATACGAGAGGCCTTGG + Intronic
1162361939 19:10225783-10225805 CTCATTGCTTTGAGAGGCCGAGG - Intronic
1162409275 19:10495260-10495282 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1162455028 19:10778399-10778421 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1162776042 19:12980075-12980097 CTCCCTGCTCTGAGAGTCTCTGG - Intergenic
1162819509 19:13214063-13214085 CTCAGTGCTTTGAGAGGCCAGGG - Intronic
1162896906 19:13770049-13770071 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1163333200 19:16654630-16654652 CTCAACACTTTGAGAGGCTTAGG - Intronic
1163415208 19:17182336-17182358 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1164544808 19:29151450-29151472 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
1164827883 19:31297707-31297729 CCCACTGCTTTGAGGGGCTGAGG - Intronic
1166324978 19:42043794-42043816 CTCACTGCTTTGGAAGGCTGAGG + Intronic
1166572711 19:43808354-43808376 CTCAATGCTTTGGGAGGCTGAGG - Intronic
1166691793 19:44826099-44826121 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1166721611 19:45000289-45000311 CTCAGGAATATGAGAGGCTTAGG + Intergenic
1166825431 19:45606153-45606175 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1167137612 19:47626656-47626678 CTCACTGCTTTGGGAGGCCAAGG - Intronic
1167558650 19:50211729-50211751 CTCAGTACTTTGAGAGGCTGAGG + Intronic
925942582 2:8835097-8835119 CTCAGTGCTTTGGGAGGCTAAGG - Intronic
926051412 2:9747137-9747159 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
926316174 2:11711892-11711914 CACACTGCTCTGAGAGCCTCAGG + Intronic
926707618 2:15847705-15847727 CCCAGTGCTGTGAGAGGCTGAGG + Intergenic
926888832 2:17621877-17621899 CTCATTGCTTTGGGAGGCTGAGG - Intronic
927760812 2:25752020-25752042 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
927820559 2:26260330-26260352 CTCACCGCTTTGGGAGGCTGAGG - Intronic
928003765 2:27544796-27544818 CCCACTGCTTTGGGAGGCTGAGG - Intronic
928305773 2:30169341-30169363 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
928526266 2:32144633-32144655 CTCACTACTTTGGGAGGCTGTGG + Intronic
928611607 2:32997258-32997280 CTCACCGCTTTGGGAGGCTGAGG + Intronic
928848327 2:35708296-35708318 TTCAGTGCTATGACAGGTTTAGG + Intergenic
928984325 2:37166275-37166297 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
929159144 2:38814186-38814208 CTCAGTACTTTGAGAGGCTGAGG - Intronic
929863124 2:45696204-45696226 CCCATTGCTTTGGGAGGCTTAGG - Intronic
930007970 2:46913295-46913317 CTCAATACTTTGAGAGGCTGAGG + Intronic
932660790 2:73649974-73649996 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
932675064 2:73772395-73772417 CTCACTGCCATAGCAGGCTTGGG - Intronic
932727739 2:74193991-74194013 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
933708869 2:85310851-85310873 CCCAATGCTTTGAGAGGCTGAGG + Intergenic
933828296 2:86184424-86184446 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
933906153 2:86895257-86895279 CTCACTGCTATTAAATGCATTGG + Intergenic
934031017 2:88046922-88046944 CCCACTGCTTTGGGAGGCTGAGG - Intronic
934752729 2:96804143-96804165 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
934769035 2:96896180-96896202 CTCCCTGCTACGGGAGGCCTGGG + Intronic
934969100 2:98748781-98748803 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
935174999 2:100641958-100641980 CTCTCTCCTTTGAGAAGCTTAGG - Intergenic
935218768 2:100994543-100994565 CTCACTGCCCTTAGGGGCTTGGG + Intronic
935330637 2:101974947-101974969 CTCCCTGCTATCAGAGGCCTAGG - Intergenic
935766997 2:106378435-106378457 CTCACTGCTATTAAATGCATTGG + Intergenic
935911773 2:107904431-107904453 CTCACTGCTATTAAATGCATTGG + Intergenic
937992832 2:127673942-127673964 CTAACTGGGAAGAGAGGCTTGGG + Intronic
938102049 2:128504123-128504145 CTCACTGCTGGGAGAGCCTCCGG - Intergenic
939257723 2:139765885-139765907 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
939516755 2:143178707-143178729 CCCAGTGCTATGGGAGGCTGAGG - Intronic
941460517 2:165766027-165766049 CCCACCACTATGGGAGGCTTAGG - Intronic
941539492 2:166764915-166764937 CCCAGTGCTTTGGGAGGCTTAGG - Intergenic
942309573 2:174642763-174642785 CCCACTGCTTTGGGAGGCTGAGG - Intronic
942345655 2:175000386-175000408 CTCAGTACTTTGAGAGGCTAAGG - Intronic
942569291 2:177297144-177297166 CTCACTACTTTGAGAGGCTGAGG - Intronic
943675128 2:190709226-190709248 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
944195025 2:197043456-197043478 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
944449741 2:199829484-199829506 CTCAGTGCAATGAGAAGTTTAGG + Intronic
944562935 2:200959812-200959834 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
945142238 2:206699181-206699203 CTCAATGCTTTGGGAGGCTGAGG + Intronic
945243898 2:207700610-207700632 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
945254749 2:207794184-207794206 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
945557430 2:211297038-211297060 CTCAGTGCTTTGAGAGGTTGAGG + Intergenic
946003831 2:216506072-216506094 CTCAGTACTATGGGAGGCTGTGG - Intronic
946803882 2:223450552-223450574 CTCAATGCTTTGGGAGGCTGAGG + Intergenic
947234098 2:227921913-227921935 CTCAGTGCTTTGAGAGGCTGAGG + Intronic
947602082 2:231459048-231459070 CTCACTGGTTTGAAAGTCTTTGG - Exonic
948912955 2:241014257-241014279 CTCACACCTTTGAGAGGCTGAGG - Intronic
1169470280 20:5879115-5879137 CCCACTGCTTTGGGAGGCTGAGG - Intergenic
1173031758 20:39367612-39367634 CTCAGTGCTTTGAGAGGCCGAGG + Intergenic
1174269151 20:49354415-49354437 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1174566614 20:51469265-51469287 CTCAGTGCTTTGAGAGGCTAAGG - Intronic
1175157360 20:56980405-56980427 CTCAGCGCTTTGAGAGGCTGAGG - Intergenic
1175325168 20:58120832-58120854 CCCACTGCTTTGAGAGGCTGAGG + Intergenic
1176050682 20:63117933-63117955 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1176949623 21:15029699-15029721 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1177052170 21:16249999-16250021 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1177742383 21:25169686-25169708 CACACAGCTATTAGAGTCTTAGG + Intergenic
1178098256 21:29238417-29238439 CTCACTCATATGTGAGACTTAGG - Intronic
1178533895 21:33397002-33397024 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1178642792 21:34359676-34359698 CCCACTGCTTTGGGAGGCTGAGG - Intergenic
1180751658 22:18128795-18128817 CCCAATGCTTTGAGAGGCTGAGG - Intronic
1181300551 22:21877725-21877747 CCCACTGCTTTGAGAGGCTGAGG + Intergenic
1182080177 22:27523242-27523264 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
1182581380 22:31314053-31314075 CTGACTGGTATGAGAGGTGTGGG - Intergenic
1183791719 22:40076651-40076673 CACACCACTTTGAGAGGCTTAGG - Intronic
1184325897 22:43784398-43784420 CTCAGTGCTTTGAGAGGCTGAGG + Intronic
1184620891 22:45675687-45675709 CACACAGATCTGAGAGGCTTAGG - Intronic
950051264 3:9991628-9991650 CCCACTGCTTTGGGAGGCTGAGG - Intronic
950300074 3:11869206-11869228 CCCACTGCTTTGGGAGGCTGAGG - Intergenic
950512092 3:13436358-13436380 CTCAATACTTTGAGAGGCTGAGG + Intergenic
950971906 3:17197620-17197642 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
951905246 3:27700030-27700052 ATCACAGCTATGGGAGGCTGAGG - Intergenic
952761338 3:36917064-36917086 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
953050678 3:39339913-39339935 CTCAATGATATGAGAGCTTTGGG - Intergenic
954324908 3:49858259-49858281 CTCACTTCTATCAGAGGCCCAGG - Exonic
955378535 3:58418067-58418089 CCCACTGTTATGGGAGGCTAAGG - Intronic
955866886 3:63393759-63393781 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
955941985 3:64154896-64154918 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
956155070 3:66287044-66287066 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
956285816 3:67608925-67608947 CTCAGTACTTTGAGAGGCTGAGG - Intronic
957064429 3:75509864-75509886 CCCAGTGCTATGAGAGGCCGAGG + Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
958604334 3:96338827-96338849 CTCACTGCTATGTGCAGCCTAGG + Intergenic
958862830 3:99466044-99466066 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
959565657 3:107830233-107830255 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
960435225 3:117618470-117618492 CCCAGTGCTTTGGGAGGCTTAGG + Intergenic
960462386 3:117952263-117952285 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
961288925 3:125829539-125829561 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
961898157 3:130186510-130186532 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
962033038 3:131621494-131621516 CCCAGTGCTCTGGGAGGCTTAGG - Intronic
964317743 3:155462170-155462192 CTGATTGCTATGAGAGGTTGGGG + Intronic
965337184 3:167440644-167440666 CTCAGCACTTTGAGAGGCTTAGG - Intergenic
965545934 3:169916393-169916415 CCCAGTGCTATGGGAGGCTGAGG + Intronic
965584754 3:170307688-170307710 CCCAGTGCTTTGAGAGGCTCAGG - Intergenic
965687386 3:171318912-171318934 CCCAGTGCTTTGAGAGGCTAAGG + Intronic
966161138 3:176969731-176969753 CTCTCTGCTTTGAGGAGCTTAGG - Intergenic
966267876 3:178068545-178068567 CCCACTGCTTTGAGAGGCTGAGG + Intergenic
966389240 3:179434468-179434490 CTCAGAGCTTTGAGAGGCTGAGG + Intronic
967324275 3:188223732-188223754 CTCTCTGCAAGGAGAAGCTTTGG + Intronic
967797741 3:193616256-193616278 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
968072836 3:195797853-195797875 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
968390318 4:187473-187495 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
968595988 4:1485283-1485305 CTCAGTGCTTTGAGAGGCTAAGG - Intergenic
969008341 4:4039936-4039958 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
969745338 4:9066451-9066473 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
969804638 4:9597439-9597461 CTCAGTGCTATGGGAGGCCGAGG - Intergenic
971298021 4:25417238-25417260 GTCCCAGCTATGAGAGGCTGAGG - Intronic
971919413 4:32917523-32917545 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
972684284 4:41336549-41336571 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
972857950 4:43130815-43130837 CCCAGTGCTACGAGAGGCTGAGG + Intergenic
974492487 4:62585169-62585191 CTCAGCGCTTTGAGAGGCTGAGG + Intergenic
978513462 4:109546708-109546730 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
980186250 4:129464449-129464471 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
980902868 4:138921695-138921717 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
980945435 4:139315267-139315289 CTCAGTGCTTTGAGAGGCAGAGG + Intronic
981008798 4:139903223-139903245 CTCAGCACTTTGAGAGGCTTAGG - Intronic
981154070 4:141413389-141413411 CTGGCTGGTATGAGAGTCTTAGG + Intergenic
981317466 4:143353984-143354006 CTCAGTGCAATGAGAGGGTGTGG - Intronic
981508911 4:145533433-145533455 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
981583725 4:146276697-146276719 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
981742374 4:148016251-148016273 CCCAGTGCTTTGAGAGGCTGGGG + Intronic
982090751 4:151878118-151878140 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
982477255 4:155868459-155868481 CCCCCTGCTATGAGCAGCTTAGG - Intronic
983170414 4:164529674-164529696 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
983229354 4:165113435-165113457 CTCAGTACTTTGAGAGGCTGAGG - Intronic
984733367 4:183088812-183088834 CTCACTACTTTGGGAGGCTGAGG - Intergenic
985513470 5:325035-325057 GTCACTGGTATGTGAGGCTGAGG + Intronic
985599395 5:818606-818628 CGCCCTGCTATGGGAGGCTGAGG + Intronic
986672737 5:10157332-10157354 TTCACTGCTCAGAGATGCTTGGG - Intergenic
987119347 5:14752055-14752077 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
987344140 5:16964010-16964032 CTCACGGCTTTGGGAGGCTGAGG - Intergenic
987836559 5:23170246-23170268 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
988028338 5:25728404-25728426 CTCACAGCTATGTGAAGTTTAGG - Intergenic
988428232 5:31089020-31089042 CTCACATCTTTGGGAGGCTTAGG + Intergenic
989038713 5:37203766-37203788 CTCAATGCTTTGGGAGGCTAAGG - Intronic
989576922 5:42996731-42996753 CTCAGTACTTTGAGAGGCATAGG - Intergenic
992616643 5:78551835-78551857 CTCTCTGCAATGAGGGTCTTAGG - Intronic
992687797 5:79215139-79215161 CCCACTGCTTTGGGAGGCTGAGG + Intronic
992962457 5:81970036-81970058 CTCTCTGCAATGAGGGTCTTAGG - Intergenic
993406185 5:87514294-87514316 ATCACTACTATGAGAGGGATTGG + Intergenic
995132286 5:108643197-108643219 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
995651683 5:114376830-114376852 CTCAATGCTTTGGGAGGCTGAGG + Intronic
997534805 5:134611112-134611134 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
998123876 5:139602424-139602446 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
998421710 5:141993613-141993635 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
998449411 5:142222770-142222792 TTCACTTCTCTGAGAGGCATGGG + Intergenic
998586038 5:143428634-143428656 CACACTGCAATGGCAGGCTTGGG + Intronic
998669600 5:144338862-144338884 CTCACTTTTATGAGATCCTTTGG + Intronic
998878190 5:146620972-146620994 ATCACTGCAATGAGAGGCACAGG + Intronic
998992717 5:147836039-147836061 CAAACTGCTATGAGAGGCAAAGG - Intergenic
1000768950 5:165326851-165326873 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1000932084 5:167263851-167263873 CTCACGGCTTTGGGAGGCTGAGG + Intergenic
1001006804 5:168059192-168059214 CTCACTGCTATAAGAAGCACTGG + Intronic
1001125541 5:169015678-169015700 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1001142451 5:169156145-169156167 CTCACTACTATGAGATGCCCAGG + Intronic
1001206764 5:169770548-169770570 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1001453578 5:171844506-171844528 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1001479838 5:172081100-172081122 CTCAGTACTTTGAGAGGCCTAGG + Intronic
1001821256 5:174712204-174712226 CTCACCGCTTTGGGAGGCTGAGG - Intergenic
1002930657 6:1632624-1632646 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1003190645 6:3871400-3871422 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1003217215 6:4125320-4125342 ACCACTGCAATCAGAGGCTTAGG + Exonic
1004093838 6:12532901-12532923 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
1004229904 6:13822883-13822905 CCCAGTGCTTTGGGAGGCTTAGG - Intergenic
1004610406 6:17234277-17234299 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
1004656156 6:17663512-17663534 CCCAGTGCTTTGAGAGGCTCAGG - Intronic
1005568036 6:27115939-27115961 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1006618442 6:35345526-35345548 CTCAGTGCTCTGAGAGGCCAAGG - Intronic
1008261028 6:49366707-49366729 CTCACTGCTCTGTGAGCCTCAGG - Intergenic
1008780413 6:55096518-55096540 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1010008073 6:71017603-71017625 CTCAGTGCTTTGAGAGGCCAAGG + Intergenic
1010138598 6:72585908-72585930 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1011491506 6:87898252-87898274 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
1013149910 6:107435024-107435046 CTCAGTACTATGAGAGGCCAAGG + Intronic
1013251032 6:108333490-108333512 CTCAACACTATGAGAGGCTGAGG + Intronic
1013420783 6:109964692-109964714 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1014047815 6:116913310-116913332 CTCAATGCTTTGGGAGGCTGAGG - Intronic
1014575003 6:123058906-123058928 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1014826124 6:126050450-126050472 CTCAGAGCTTTGAGAGGCTGAGG + Intergenic
1015157794 6:130116500-130116522 CTCAATGCTTTGAGAGGGTGAGG + Intronic
1015519534 6:134116267-134116289 CTCAGTACTTTGAGAGGCTGGGG - Intergenic
1016042837 6:139449876-139449898 CTCCTTGCTATGAGAGCTTTAGG - Intergenic
1016637360 6:146309146-146309168 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1017173974 6:151484518-151484540 CTCAGTGCTTTAAGAGGCTCAGG - Intergenic
1017175396 6:151498055-151498077 CTCACTGGTGTCAGAGGATTTGG - Intronic
1017208667 6:151831388-151831410 CTCACTGCTCTGGAAGGCTGCGG - Intronic
1017448855 6:154534660-154534682 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1017687370 6:156926928-156926950 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1018007340 6:159634840-159634862 CTCAGTACTTTGAGAGGCTAAGG + Intergenic
1018032283 6:159850966-159850988 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1019099141 6:169613354-169613376 CTCTCTGCTATATGTGGCTTAGG - Intronic
1020012462 7:4814028-4814050 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1020328802 7:6997740-6997762 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
1021652676 7:22846968-22846990 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1022296118 7:29055499-29055521 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1023371709 7:39518520-39518542 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1023483284 7:40658080-40658102 TTCACTGTCATTAGAGGCTTTGG - Intronic
1023849671 7:44143270-44143292 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
1025083232 7:56002451-56002473 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1026295769 7:69050977-69050999 CTCAATGCTTTGGGAGGCTGAGG + Intergenic
1026327524 7:69323585-69323607 CTCATTGCTTTGGGAGGCTGAGG + Intergenic
1026505168 7:70976455-70976477 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1026588692 7:71678545-71678567 CCCAGTGCTATGGGAGGCTGAGG + Intronic
1026651275 7:72217725-72217747 CCTAATGCTATGGGAGGCTTAGG + Intronic
1027162418 7:75812335-75812357 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1027176785 7:75909123-75909145 CCCAGTGCTATGGGAGGCTGAGG + Intronic
1027381470 7:77614133-77614155 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1027921323 7:84399393-84399415 CACACTGCTCTCAGAGGCTGTGG + Intronic
1028211937 7:88084335-88084357 TTCCCTGGTATGACAGGCTTAGG - Intronic
1029046405 7:97633912-97633934 CCCACTGCTTTGGGAGGCTGAGG + Intergenic
1029092734 7:98060917-98060939 CCCAGTGCTGTGAGAGGCTGAGG - Intergenic
1029120600 7:98265423-98265445 CCCACTGCTTTGGGAGGCTGAGG - Intronic
1029153670 7:98499629-98499651 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1029362421 7:100097181-100097203 CCCAATGCTCTGAGAGGCTGAGG - Intronic
1030583296 7:111386126-111386148 CCCACTGCTTTGGGAGGCTGTGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032621523 7:133538563-133538585 CTCAGTACTATGGGAGGCTGAGG + Intronic
1033019898 7:137713887-137713909 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1033798066 7:144871064-144871086 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1034127170 7:148683968-148683990 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1034463174 7:151209744-151209766 CTCAGTTCTTTGAGGGGCTTAGG - Intronic
1036027327 8:4924470-4924492 CTCAGTACTTTGAGAGGCTGGGG + Intronic
1036249623 8:7150643-7150665 CCCAGTGCTATGGGAGGCTGAGG + Intergenic
1037781963 8:21875623-21875645 CTCAGTGCTTTGAGAAGCTGAGG - Intergenic
1037849206 8:22312514-22312536 CTCACTGCTTTGGGAGGTTGAGG - Intronic
1038066527 8:23968942-23968964 CCCAGTGCTATGGGAGGCTGAGG - Intergenic
1038457394 8:27686188-27686210 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1038567611 8:28633086-28633108 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1038711856 8:29954459-29954481 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1039404401 8:37300240-37300262 CTCTCTGCTATGCCAGGCTGAGG + Intergenic
1039525797 8:38215013-38215035 CCTACTGCTTTGAGAGGCTGAGG + Intergenic
1039892775 8:41696138-41696160 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1040401171 8:47051398-47051420 CTCACTGCTTTGTGCAGCTTTGG + Intergenic
1040550926 8:48437063-48437085 CTCACTGCTCTGAGCTGCTGGGG + Intergenic
1040699418 8:50042845-50042867 CCCACTGCTTTGAGAGGCTAAGG - Intronic
1041067917 8:54100231-54100253 CTCTGTGCTTTGAGAGGCTGAGG + Intronic
1041080865 8:54213860-54213882 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1041082066 8:54223532-54223554 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1042141205 8:65680413-65680435 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1042401534 8:68354455-68354477 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1042911166 8:73827793-73827815 CTCAATGCTTTGAGAGGCTGAGG - Intronic
1042923363 8:73941479-73941501 GTCCCAGCTATGAGAGGCTGAGG + Intronic
1043397881 8:79856308-79856330 CTCAATGCTTTGGGAGGCTGAGG + Intergenic
1045000476 8:97873876-97873898 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1045051505 8:98331364-98331386 CCCAGTGCTTTGGGAGGCTTAGG + Intergenic
1046652964 8:116859489-116859511 CCCAGTGCTTTGGGAGGCTTAGG - Intronic
1046848918 8:118951667-118951689 CTCCCTCCCAGGAGAGGCTTGGG - Intronic
1047514520 8:125542034-125542056 CCCACTGATAGGAGAGGTTTGGG + Intergenic
1049790314 8:144469373-144469395 CTCAAGGGTATGACAGGCTTGGG + Exonic
1050104210 9:2148757-2148779 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1050427518 9:5526686-5526708 CTCAGTGCTTTGGGAGGCTGGGG - Intronic
1050523933 9:6529371-6529393 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1050778718 9:9302848-9302870 CACACTGCTATGAGAAACTACGG - Intronic
1051248006 9:15131217-15131239 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1051302380 9:15665528-15665550 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1051385964 9:16509074-16509096 CTCAATGCTTTGGGAGGCTGAGG - Intronic
1051397407 9:16639664-16639686 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1052169246 9:25373753-25373775 CCCACTGCTTTGAGAGGCCAAGG + Intergenic
1052976427 9:34413993-34414015 CACACTGCCATGAGATGTTTTGG - Intronic
1055606473 9:77975888-77975910 CTCACTGCAATGAGAGTCATAGG + Intronic
1057090349 9:92252514-92252536 ACCACTGCTTTGAGAGGCTGAGG + Intronic
1057941291 9:99287530-99287552 CTCAATGCTTTGGGAGGCTGAGG - Intergenic
1057967212 9:99515961-99515983 CTCACAGCTCTGAGAAGCTCTGG - Intergenic
1058062973 9:100518214-100518236 CCCAGTGCTTTGGGAGGCTTAGG + Intronic
1058709852 9:107669726-107669748 GTCACTACTGTGAAAGGCTTAGG - Intergenic
1058878094 9:109261443-109261465 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1058980335 9:110162960-110162982 CTCAATGCTTTGGGAGGCTGAGG - Intronic
1059623467 9:116034923-116034945 CCCACCGCTTTGAGAGGCTGAGG - Intergenic
1060237410 9:121874992-121875014 CTTACAGCTATAAGTGGCTTTGG + Intronic
1060577954 9:124715270-124715292 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1061265277 9:129501150-129501172 CTCACTGGTATCAGATGCTCAGG + Intergenic
1061443203 9:130621231-130621253 CCCAGTGCTTTGAGAGGCTTAGG + Intronic
1061997036 9:134191454-134191476 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1062737660 9:138147095-138147117 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1185545666 X:941856-941878 TTCACTGGTGTGTGAGGCTTAGG + Intergenic
1185639961 X:1584434-1584456 CCCACTGCTTTCAGAGGCTGAGG - Intergenic
1185952092 X:4448721-4448743 CTCATTGCTTTAAGAGGCTGAGG - Intergenic
1187186095 X:16987183-16987205 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
1187517429 X:19985326-19985348 CCCACTGCTTTGGGAGGCTAAGG + Intergenic
1187552502 X:20319954-20319976 CCCACTGCTTTGAGAGGCTGAGG - Intergenic
1187647241 X:21361566-21361588 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
1188114120 X:26223104-26223126 CTCTCTGTCATGAGATGCTTGGG - Intergenic
1188425379 X:30041046-30041068 CACACTGTGATAAGAGGCTTAGG + Intergenic
1188711235 X:33401870-33401892 CTCACTTCTATGAAAGTTTTTGG - Intergenic
1189760558 X:44317533-44317555 CTCAATACTTTGGGAGGCTTAGG + Intronic
1189997502 X:46653142-46653164 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1190896001 X:54618644-54618666 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1192386205 X:70673371-70673393 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1192540234 X:71962886-71962908 CCCAATGCTTTGAGAGGCTGAGG - Intergenic
1192544707 X:72004114-72004136 CTCACTGCTGCCAGAGGCTTTGG - Intergenic
1193311698 X:80017412-80017434 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1193519778 X:82514218-82514240 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1196066351 X:111468745-111468767 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1196141058 X:112264035-112264057 CTCAATGAAATAAGAGGCTTAGG + Intergenic
1196669834 X:118354163-118354185 CCCAGTGCCATGAGAGGCTGAGG + Intronic
1196670229 X:118358450-118358472 CCCAGTGCCATGAGAGGCTGAGG + Intronic
1197004875 X:121483255-121483277 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1197333833 X:125187010-125187032 CCCAATGCTTTGAGAGGCTGAGG + Intergenic
1197921975 X:131604515-131604537 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1198457341 X:136829389-136829411 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1199711885 X:150475317-150475339 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1199924465 X:152448351-152448373 TTCAGAGTTATGAGAGGCTTCGG - Intronic
1200175378 X:154111452-154111474 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1201381587 Y:13385799-13385821 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1201417413 Y:13761194-13761216 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1201687644 Y:16725108-16725130 CTCAGTACTTTGAGAGGCTAAGG - Intergenic