ID: 1148523752

View in Genome Browser
Species Human (GRCh38)
Location 17:48309399-48309421
Sequence ATTGTCAAGGCCATGCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148523752_1148523756 27 Left 1148523752 17:48309399-48309421 CCAGTAAGCATGGCCTTGACAAT 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1148523756 17:48309449-48309471 ATAATATCCTTAACTTAAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 177
1148523752_1148523754 -2 Left 1148523752 17:48309399-48309421 CCAGTAAGCATGGCCTTGACAAT 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1148523754 17:48309420-48309442 ATTCTCAAGTAAATTTTCTAAGG 0: 1
1: 0
2: 1
3: 31
4: 413
1148523752_1148523755 24 Left 1148523752 17:48309399-48309421 CCAGTAAGCATGGCCTTGACAAT 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1148523755 17:48309446-48309468 TAAATAATATCCTTAACTTAAGG 0: 1
1: 0
2: 4
3: 25
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148523752 Original CRISPR ATTGTCAAGGCCATGCTTAC TGG (reversed) Intronic
901843336 1:11966860-11966882 ATTGACAAGGCCCTGCTCCCCGG + Intronic
905508630 1:38501057-38501079 ATTGTCAAGGCCTTGCTTCCTGG - Intergenic
910914330 1:92273301-92273323 ATTTTCAAAGCCATGCATTCTGG + Intronic
918687145 1:187431276-187431298 ATTGACAAGTCCAAGGTTACAGG - Intergenic
921191315 1:212711096-212711118 ATTGTCAAGGAAAGGCTTTCTGG - Intergenic
921785752 1:219227994-219228016 CTTGTCACCGCCATGCTAACAGG + Intergenic
923590551 1:235315134-235315156 ATTGTCCAGGCCAGGCTTGGTGG + Intronic
1064678708 10:17787390-17787412 ATCGTCATGGCCTTGCTTAAGGG + Intronic
1068148644 10:53103302-53103324 ACTATAAAGGCCATGCTTATTGG - Intergenic
1071380558 10:85055210-85055232 ATTGTCAAAGCCAAGCTTCCTGG + Intergenic
1071735644 10:88296427-88296449 AATGTCAATGCCATGCTTCTGGG - Intronic
1073873078 10:107888535-107888557 ATTGTCAAGGCCAGGCATGGTGG + Intergenic
1076954551 10:133689266-133689288 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1076954606 10:133689742-133689764 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1076954614 10:133689810-133689832 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1076961351 10:133764496-133764518 CTTGTCTAGGCTCTGCTTACGGG - Intergenic
1078230224 11:9434512-9434534 AATGTTAAGGCCAGGCTTAGTGG + Intronic
1081850246 11:46270730-46270752 ATTGCCAAGGCCAAGCCTGCTGG + Intergenic
1088164938 11:106923525-106923547 ATTGACAATGGCATGTTTACGGG - Intronic
1089220377 11:116866035-116866057 ATTGTCAAGGCCTTGCCTGCTGG - Intronic
1100170133 12:91965833-91965855 TTTCTCAAAGCAATGCTTACTGG + Intergenic
1101120911 12:101579204-101579226 ATTGTTAAGGCCATGGATTCAGG + Intronic
1103781784 12:123403472-123403494 ATTGCCCAGGCCATGCCCACCGG - Intronic
1106519794 13:30486623-30486645 ACTGTCAAGGCCACTCTTGCTGG + Intronic
1107141549 13:37003820-37003842 AATGTCAGAGCCATACTTACTGG - Intronic
1108200016 13:48033976-48033998 TTTGTAATGGCCATTCTTACAGG - Intergenic
1110037366 13:70705048-70705070 ATTTTTAAAGCCATCCTTACTGG + Intergenic
1114694767 14:24616378-24616400 ATGGTGAAGGCCATGCTTAGAGG + Intergenic
1117462266 14:55957002-55957024 AATCTCAAGGCTATGCTCACTGG + Intergenic
1119099148 14:71863981-71864003 CTTGTAAAGGACATGCTTAGAGG - Intergenic
1202848851 14_GL000225v1_random:2971-2993 CTTGTCAAGGTTTTGCTTACAGG - Intergenic
1202848916 14_GL000225v1_random:3517-3539 CTTGTCTAGGCCCTGCTTACAGG - Intergenic
1202849207 14_GL000225v1_random:6244-6266 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202849274 14_GL000225v1_random:6787-6809 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1202849282 14_GL000225v1_random:6855-6877 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1202850126 14_GL000225v1_random:11175-11197 ATTGTCTAGGCTCTGCCTACAGG - Intergenic
1202850348 14_GL000225v1_random:13230-13252 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202850433 14_GL000225v1_random:13977-13999 ATTGTCAAGGCTCTGCCTAGAGG - Intergenic
1202850554 14_GL000225v1_random:15069-15091 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1202850805 14_GL000225v1_random:17461-17483 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1202850846 14_GL000225v1_random:17869-17891 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202850884 14_GL000225v1_random:18212-18234 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1202850891 14_GL000225v1_random:18279-18301 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1202851211 14_GL000225v1_random:21280-21302 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202851271 14_GL000225v1_random:21824-21846 ATTGTCAAGGCTCTGCTTAAAGG - Intergenic
1202851899 14_GL000225v1_random:26086-26108 GTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202851956 14_GL000225v1_random:26563-26585 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1202852005 14_GL000225v1_random:27110-27132 CTTGTCTATGCTATGCTTACAGG + Intergenic
1202852286 14_GL000225v1_random:29531-29553 TTTGTCAAGGATATGGTTACAGG + Intergenic
1202852973 14_GL000225v1_random:32507-32529 ATTGTCTGGGCTTTGCTTACAGG - Intergenic
1202853143 14_GL000225v1_random:34143-34165 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202854039 14_GL000225v1_random:38739-38761 CTTGTCAAGGTTCTGCTTACAGG - Intergenic
1202855664 14_GL000225v1_random:50203-50225 ATTGTCTAGGCTTTGCCTACCGG - Intergenic
1202855795 14_GL000225v1_random:51359-51381 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1202856598 14_GL000225v1_random:55204-55226 CTTGTCAAGGTTCTGCTTACAGG - Intergenic
1202858648 14_GL000225v1_random:66523-66545 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202858870 14_GL000225v1_random:68573-68595 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1202859124 14_GL000225v1_random:70828-70850 CTTGTCAAGGTTCTGCTTACAGG + Intergenic
1202860089 14_GL000225v1_random:76023-76045 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1202860191 14_GL000225v1_random:76910-76932 CTTGTCTAGGCTGTGCTTACAGG + Intergenic
1202860272 14_GL000225v1_random:77662-77684 TTTGTCAAGGTTCTGCTTACAGG + Intergenic
1202861257 14_GL000225v1_random:83204-83226 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202861368 14_GL000225v1_random:84296-84318 GTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202861548 14_GL000225v1_random:85868-85890 CTTGTCAAGGCTCTGCCTACTGG + Intergenic
1202861797 14_GL000225v1_random:88117-88139 CTTGTCAAGGTTCTGCTTACAGG + Intergenic
1202862610 14_GL000225v1_random:92097-92119 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202862717 14_GL000225v1_random:93115-93137 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1202863705 14_GL000225v1_random:101680-101702 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1202863791 14_GL000225v1_random:102430-102452 CTTGTCAAGGCTCTGCTTACAGG + Intergenic
1202864442 14_GL000225v1_random:105899-105921 CTTGTCAAGGTTCTGCTTACAGG - Intergenic
1202864663 14_GL000225v1_random:107945-107967 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1202864945 14_GL000225v1_random:110537-110559 ATTGTCTAGGCTTTGCCTACAGG - Intergenic
1202864987 14_GL000225v1_random:110944-110966 CTTGTCAAGGCCCTGCCTACAGG - Intergenic
1202865049 14_GL000225v1_random:111487-111509 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1202865885 14_GL000225v1_random:116775-116797 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1202866061 14_GL000225v1_random:118345-118367 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202866377 14_GL000225v1_random:121355-121377 CTTGTCTAGGCTATGCCTACTGG + Intergenic
1202867255 14_GL000225v1_random:129572-129594 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1202867474 14_GL000225v1_random:131543-131565 ATTGTCCAGGCTTTGCCTACAGG + Intergenic
1202868689 14_GL000225v1_random:139381-139403 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1202868883 14_GL000225v1_random:141172-141194 ATTGTCTAGGCTCTGCTTACAGG + Intergenic
1202868959 14_GL000225v1_random:141854-141876 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1202869231 14_GL000225v1_random:144592-144614 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1202922372 14_KI270723v1_random:37049-37071 CTTGTCAAGGTTCTGCTTACAGG - Intergenic
1202922567 14_KI270724v1_random:565-587 CTTGTCAAGGTTCTGCTTACAGG + Intergenic
1125365189 15:38905913-38905935 ATTGTCAAGGACATACTTTTAGG + Intergenic
1125618772 15:41040460-41040482 ATTGAAAAGACCATTCTTACTGG - Intronic
1126811486 15:52410263-52410285 ATTGTTGAGTCCATGCTTGCTGG - Intronic
1127051378 15:55087783-55087805 ATTGGCTAGGACATGGTTACCGG - Intergenic
1128763652 15:70237129-70237151 ATTGCAAAGGACATGTTTACAGG + Intergenic
1131372023 15:91890499-91890521 ATTGTCAATGCCAGGCATAGGGG - Intronic
1134834140 16:17347211-17347233 TTTGTGAAGGCCTTGCTTGCAGG + Intronic
1141616621 16:85213521-85213543 TTTGTCATTGCCATGCTTGCAGG + Intergenic
1141914247 16:87083402-87083424 ATGGTCAAGGCCAAAGTTACTGG + Intergenic
1143391145 17:6560009-6560031 TTTGTCAAGGCCATGGTGATTGG - Intergenic
1144277992 17:13694736-13694758 ATAGTAAAGGCAGTGCTTACAGG - Intergenic
1148523752 17:48309399-48309421 ATTGTCAAGGCCATGCTTACTGG - Intronic
1149734997 17:58985753-58985775 ATTGTAAAGGCCTTCTTTACTGG - Intronic
1152965009 18:106537-106559 CTTGTCTAGGCTCTGCTTACGGG + Intergenic
1152965063 18:107013-107035 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1152965179 18:107966-107988 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1152965187 18:108034-108056 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1152965244 18:108511-108533 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1152965543 18:111173-111195 ATTGTCTGGGCTTTGCTTACAGG + Intergenic
1156468146 18:37361103-37361125 CTTGTGAAGGCCATTCATACAGG + Intronic
1161211923 19:3071066-3071088 ATTGTCCAGGCCAGGCCTGCTGG - Intergenic
1165102558 19:33447466-33447488 ATTGTCACTGCCATGCATCCCGG - Intronic
1166800991 19:45456858-45456880 ATTGTAATAGCTATGCTTACGGG + Intronic
1168680984 19:58315765-58315787 GTGGTCATGGCCATGCATACAGG - Intergenic
925947062 2:8874964-8874986 ATTATCAATGCACTGCTTACAGG + Intronic
926174952 2:10582580-10582602 ATTGGGAAGGCCATGCTTGTTGG - Intronic
926745654 2:16154923-16154945 ATTGACAAGGCTATGCTTTCAGG + Intergenic
927247670 2:20970746-20970768 CTTGTCAATGCCTTGCTTTCAGG + Intergenic
929103836 2:38344255-38344277 ATTTTCTAGGTGATGCTTACAGG - Intronic
931402489 2:61943874-61943896 ATTGTCCAGGAAATGCATACAGG - Intronic
931716759 2:65035144-65035166 ATTGTCAAGGCCAGGCACAGTGG - Intergenic
934131066 2:88949349-88949371 ATTGTCAAGGAAATTCTTCCTGG - Intergenic
942544134 2:177045005-177045027 AGTGTAAAGGCCATGCTCAGTGG - Intergenic
943282793 2:185958876-185958898 TTTGTCATGGCCATTCTTGCAGG + Intergenic
946124601 2:217551539-217551561 ATTCTCAGGGCCATACTTCCAGG - Intronic
947017390 2:225636453-225636475 ATTACCAAGGGCATGATTACAGG - Intronic
1169808274 20:9581760-9581782 ATTGTCAAGGCACGGCTGACGGG - Intronic
1171512077 20:25694354-25694376 AATGTCATAGCCATGCCTACTGG - Intronic
1173320516 20:41983388-41983410 CTTTTCAAGGCCATGCATATTGG - Intergenic
1183013172 22:34964108-34964130 ATTGTCAAGCACATGCATGCAGG + Intergenic
1183611489 22:38910071-38910093 ATTGTCAAGGCCATGCATGGTGG + Intergenic
951568900 3:24041414-24041436 ATGGTCAAAGCCAAGCTTATAGG + Intergenic
953943203 3:47120718-47120740 ACTGGCAAGGCAATGGTTACTGG - Exonic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955143102 3:56289261-56289283 GTTGTCAAGGTCCTGCCTACAGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
958724407 3:97887216-97887238 AGTATCAAATCCATGCTTACCGG - Intronic
966019205 3:175187081-175187103 ATTGTCAAGGCCCTGATGACTGG + Intronic
966249135 3:177842642-177842664 AGTGTCAAAGCCATTCTTAAGGG + Intergenic
967254741 3:187578520-187578542 ACTGTCAAGTCCTTGCTTATAGG - Intergenic
971449615 4:26787763-26787785 GTTGTCAAGGTCAGGCTTAGAGG - Intergenic
971937360 4:33169055-33169077 ATTCTCAAGGCCATGCGCAGTGG - Intergenic
972139106 4:35934055-35934077 ATGGTCAAGGCCTTGCATTCTGG + Intergenic
977262937 4:94819711-94819733 ATTTTCAAGTACATGCTGACAGG + Intronic
980452545 4:132993632-132993654 ATTACCAAGGCCAAGCTTATTGG + Intergenic
981531467 4:145758398-145758420 ATTGTCAGGGCCACCCTTTCAGG + Intronic
984228799 4:177068236-177068258 ACTGTCAAGCCTATACTTACTGG - Intergenic
985464236 4:190179378-190179400 CTTGTCAAGGCTCTGCCTACAGG - Intronic
985464292 4:190179854-190179876 CTTGTCTAGGCTCTGCTTACAGG - Intronic
985464300 4:190179922-190179944 ATTGTCTAGGCTCTGCTTAAAGG - Intronic
985464395 4:190181020-190181042 CTTGTCTAGGCTCTGCTTACAGG - Intronic
985464403 4:190181088-190181110 ATTGTCTAGGCTCTGCTTAAAGG - Intronic
989059374 5:37395201-37395223 ATGGTGAGGGCTATGCTTACAGG + Intronic
989120924 5:38003886-38003908 ATGGTCACTGCCGTGCTTACTGG - Intergenic
992617633 5:78560334-78560356 ATTGCCAAGGGCATGATTGCTGG - Intronic
993033860 5:82735408-82735430 ATTCCAAAGGCCATGCTTAAAGG - Intergenic
1000394542 5:160759978-160760000 AACGTGTAGGCCATGCTTACAGG + Intronic
1003245758 6:4380701-4380723 ATGGTCAAGTTCATGCTTACTGG - Intergenic
1007380445 6:41487129-41487151 ACTGTCACTGCCATCCTTACAGG - Intergenic
1008488883 6:52064794-52064816 ATTGTCAAGGCTCTCCTTTCAGG - Intronic
1009242062 6:61195878-61195900 ATTGTCAAGGCCATGAAAAGGGG - Intergenic
1009462142 6:63926110-63926132 ATTGACAAGCCCATGCTGATAGG - Intronic
1010457507 6:76075242-76075264 ATTCCCAAGACCATGCTTTCTGG + Intergenic
1010661678 6:78578667-78578689 ATGGTCAAGGCCATGCTTGGTGG - Intergenic
1012883530 6:104818950-104818972 GTTTTCAAGGTAATGCTTACAGG - Intronic
1013802486 6:113963583-113963605 ATAGTCAAGGAAATGCTAACTGG + Intronic
1014562014 6:122902243-122902265 ATTTTTAAGGCTATGGTTACTGG - Intergenic
1014630328 6:123781580-123781602 ATTCTAAAGTCCATGCTTACTGG - Intergenic
1016051673 6:139536515-139536537 ATGGACAAGGTCATCCTTACAGG - Intergenic
1017427966 6:154342140-154342162 ATTGGCATGTCCATGCTTATGGG - Intronic
1025834140 7:65079985-65080007 ATTTTCAAGGCCAGGCATAGTGG - Intergenic
1025903910 7:65769502-65769524 ATTTTCAAGGCCAGGCATAGTGG - Intergenic
1033204268 7:139403989-139404011 ATGGTCAAGGACATGGATACAGG + Intronic
1035785408 8:2255988-2256010 AATTTCAAGGCCATGTTTAAGGG + Intergenic
1035807400 8:2465728-2465750 AATTTCAAGGCCATGTTTAAGGG - Intergenic
1043700896 8:83287909-83287931 AGTGGCATGGCCAGGCTTACTGG + Intergenic
1043973527 8:86559977-86559999 ATTGCCAAGGCCAGGCTGAGAGG + Exonic
1049069662 8:140346702-140346724 TTTGGCAAGTCCATCCTTACAGG - Intronic
1055474190 9:76645151-76645173 ATTGCTAAGGCCATGCTGAGGGG + Intronic
1056299888 9:85230013-85230035 ATTGTAAAGGGCGTGCATACAGG + Intergenic
1058393407 9:104522701-104522723 ATTGTACAGCCCATGCTTCCTGG + Intergenic
1060541330 9:124432470-124432492 ATTGTCATGTCCAAGCTTCCAGG + Intergenic
1062652121 9:137583357-137583379 ATAGATGAGGCCATGCTTACGGG - Intronic
1203735642 Un_GL000216v2:136550-136572 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1203735919 Un_GL000216v2:139288-139310 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1203736085 Un_GL000216v2:140874-140896 ATTGTCTAGGCTTTGCCTACAGG - Intergenic
1203737269 Un_GL000216v2:148521-148543 ATTGTCCAGGCTTTGCCTACAGG - Intergenic
1203738078 Un_GL000216v2:156033-156055 ATTGTCTAGGCTTTGCCTACAGG - Intergenic
1203739288 Un_GL000216v2:164606-164628 CTTGTCTAGGCTTTGCTTACAGG + Intergenic
1203739340 Un_GL000216v2:165081-165103 CTTGTCAAGGCCCTGTCTACAGG + Intergenic
1203739381 Un_GL000216v2:165488-165510 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1203739597 Un_GL000216v2:167527-167549 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1203739882 Un_GL000216v2:170118-170140 CTTGTCAAGGTTCTGCTTACAGG + Intergenic
1203740533 Un_GL000216v2:173583-173605 CTTGTCAAGGCTATGCTTACAGG - Intergenic
1203740614 Un_GL000216v2:174333-174355 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1190752836 X:53377073-53377095 GTTGTCAAGGCTATGCTCACGGG - Exonic
1193184419 X:78495458-78495480 ATTGTCTAGGGCATGACTACTGG + Intergenic
1194844270 X:98784070-98784092 ATTGGCAAGACCATATTTACAGG + Intergenic
1196249460 X:113442953-113442975 ATTGCTAAAGCCATGTTTACAGG + Intergenic
1200843708 Y:7810059-7810081 TTTGCCAGGGCCATGCTTTCAGG - Intergenic
1200859490 Y:7975123-7975145 TTTGCCAGGGCCATGCTTTCAGG - Intergenic
1200890820 Y:8322230-8322252 TTTGTCAGGGTCATGCTTTCAGG + Intergenic
1200894505 Y:8360478-8360500 TTTGTCAGGGCCATGCTTTAAGG - Intergenic
1200906992 Y:8493943-8493965 TTTGCCAAGGCCATGCTTTCAGG + Intergenic
1201124916 Y:10904048-10904070 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1201125372 Y:10908420-10908442 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1201125665 Y:10911790-10911812 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1201125748 Y:10912541-10912563 ATTGTCTAGGCTCTGCCTACAGG - Intergenic
1201175208 Y:11304432-11304454 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1201175306 Y:11305314-11305336 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1201175331 Y:11305519-11305541 CTTGTCAAGGCCCTGCCTACAGG - Intergenic
1201176481 Y:11312435-11312457 ATTGTCTAGGCTTTGCCTACAGG - Intergenic
1201176589 Y:11313386-11313408 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1201177397 Y:11317300-11317322 GTTGTCAAGGTTCTGCTTACAGG - Intergenic
1201177702 Y:11319965-11319987 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1201177710 Y:11320033-11320055 ATTGTCTAGGCTCTGCTTAAAGG - Intergenic
1201177793 Y:11320712-11320734 GTTGTCTAGGCTCTGCTTACAGG - Intergenic
1201178511 Y:11323939-11323961 CTTGTCAAGGTTCTGCTTACAGG - Intergenic
1201178996 Y:11328447-11328469 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1201179068 Y:11329129-11329151 ATTGTCTAGGCTTTGCCTACAGG - Intergenic
1201179115 Y:11329536-11329558 CTTGTCAAGGCTCTGCCTACAGG - Intergenic
1201179171 Y:11330012-11330034 CTTGTCTAGGCTCTGCTTACAGG - Intergenic
1202623947 Y:56838501-56838523 ATTGTCTAGGCTTTGCCTACAGG + Intergenic
1202624415 Y:56842799-56842821 ATTGTCTAGGCTCTGCTTAAAGG + Intergenic
1202624423 Y:56842867-56842889 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202624483 Y:56843344-56843366 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1202624634 Y:56844844-56844866 CTTGTCTAGGCATTGCTTACAGG + Intergenic
1202624938 Y:56847521-56847543 CTTGTCTAGGCTCTGCTTACAGG + Intergenic
1202625004 Y:56848133-56848155 CTTGTCAAGGCTCTGCCTACAGG + Intergenic
1202625276 Y:56850797-56850819 CTTGTCAAGGCTCTGCCTACAGG + Intergenic