ID: 1148533109

View in Genome Browser
Species Human (GRCh38)
Location 17:48414308-48414330
Sequence CTGGGGGAAAGGTGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1085
Summary {0: 1, 1: 0, 2: 12, 3: 109, 4: 963}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148533100_1148533109 4 Left 1148533100 17:48414281-48414303 CCAAAATTAGCAGGCCAAGAATG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963
1148533097_1148533109 7 Left 1148533097 17:48414278-48414300 CCCCCAAAATTAGCAGGCCAAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963
1148533095_1148533109 14 Left 1148533095 17:48414271-48414293 CCTGAAACCCCCAAAATTAGCAG 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963
1148533105_1148533109 -10 Left 1148533105 17:48414295-48414317 CCAAGAATGTGTACTGGGGGAAA 0: 1
1: 1
2: 0
3: 31
4: 321
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963
1148533099_1148533109 5 Left 1148533099 17:48414280-48414302 CCCAAAATTAGCAGGCCAAGAAT 0: 1
1: 0
2: 1
3: 21
4: 169
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963
1148533098_1148533109 6 Left 1148533098 17:48414279-48414301 CCCCAAAATTAGCAGGCCAAGAA 0: 1
1: 0
2: 2
3: 18
4: 264
Right 1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG 0: 1
1: 0
2: 12
3: 109
4: 963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148533109 Original CRISPR CTGGGGGAAAGGTGGGAAGT TGG Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900945776 1:5830702-5830724 CTGGGGGACAGGGAGGGAGTGGG - Intergenic
901031577 1:6310226-6310248 CGGGAGAAAAGGTGGGAAGAGGG + Intronic
901190664 1:7408020-7408042 GTGGGAGAAAGGTTGGAAGCAGG + Intronic
901490703 1:9595008-9595030 CTGGGGGAGAGGTGGAGAGTCGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901811490 1:11769168-11769190 GTGGGGGCAAGGCAGGAAGTTGG - Intronic
902214381 1:14924874-14924896 CTGGGGGAAGCGTGGGAAAGGGG + Intronic
902286835 1:15412598-15412620 CTGGGGGAAAGGAGAGACGGGGG - Intronic
902622143 1:17656716-17656738 CTGGGGGGAATGGGGGAAGGGGG + Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
903773384 1:25778082-25778104 CTGGGAGCAAGGTGGGGATTGGG - Intronic
904588598 1:31594405-31594427 CTGGGTGAGAGGTGACAAGTGGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904727187 1:32558136-32558158 TGGGGGAAAAGGAGGGAAGTAGG + Intronic
904879310 1:33682937-33682959 CTGGGGAAAAGGTGGGGAGTGGG - Intronic
905251056 1:36648675-36648697 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905863304 1:41364093-41364115 CATGGGGAAAGATGGGAAGAGGG + Intronic
905875676 1:41430872-41430894 CTGGGGAAAAGGTGGGCAGTGGG + Intergenic
905974894 1:42167809-42167831 CTGGGGGAAAGGTGAGGGGCAGG + Intergenic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
907076630 1:51584907-51584929 ATGGGGAAAAGGTGGGCATTTGG + Intronic
907163895 1:52392899-52392921 CTCGGGGAAGGGTGGAAGGTGGG + Intronic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
907888668 1:58617642-58617664 ATTTGGGAAAGTTGGGAAGTTGG - Intergenic
908066027 1:60405449-60405471 AGGGTGGGAAGGTGGGAAGTGGG + Intergenic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
908463321 1:64367225-64367247 CTGGGGGAAAGGAGGCAATGGGG + Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909373044 1:74909112-74909134 GTGGGGTAAAGGTGGGAGATAGG - Intergenic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
909655441 1:78026707-78026729 ATGGAGGAAAGGTGGGAATGGGG - Intronic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910137964 1:83995079-83995101 CTGGGAGAAAGGCAGGCAGTTGG - Intronic
910269776 1:85381489-85381511 CTGGGGGAAGGTTGGGAGGGGGG - Intronic
910351451 1:86303457-86303479 CTAGGGGCAAGATGGGAAGGAGG + Intergenic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
911689623 1:100818208-100818230 AGGGGGGAAGGGTGGGAAGGGGG + Intergenic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912121059 1:106472890-106472912 CAGTGGGCAAGGTGGCAAGTGGG + Intergenic
912382805 1:109256397-109256419 CTGGAGGGTAGGTGGGCAGTCGG + Intronic
912422483 1:109553852-109553874 CGGGGGAAAGGGTGGGAAGGTGG - Intronic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912760736 1:112365114-112365136 CTGGGGGAAAGGGGCAAAGTGGG + Intergenic
913091430 1:115479117-115479139 CGGGGGGAAAGGGGGGAAAGGGG + Intergenic
913356143 1:117924274-117924296 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
913587566 1:120290617-120290639 AAGGGGAAAGGGTGGGAAGTGGG - Intergenic
913620619 1:120607752-120607774 AAGGGGAAAGGGTGGGAAGTGGG + Intergenic
913965990 1:143377937-143377959 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914060364 1:144203545-144203567 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
914118786 1:144762824-144762846 CTGGGGGAGAGGTCGGAAGTGGG + Intergenic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
914457123 1:147846429-147846451 CTGATGGAAAGCTGGGAAGGAGG + Intergenic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915552091 1:156641263-156641285 CTGGGGGAAAGGAGGGTCATTGG + Intergenic
915992214 1:160529544-160529566 CTGGGGGAAGGGGCGGATGTGGG - Intergenic
916061240 1:161099820-161099842 AGGGGGGGAAGGTGGGAAGATGG + Intronic
916624968 1:166545735-166545757 CGGGGGAAAGGGTGGAAAGTGGG - Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
916918804 1:169439794-169439816 CAGAGGGATAGGTGGGAAGCTGG + Intronic
917316943 1:173735747-173735769 CAGGGGGAAGTGTGGGAGGTGGG - Intronic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
918012005 1:180595597-180595619 CTGAGGCACAGGTGGGAATTGGG + Intergenic
918128201 1:181602931-181602953 CTGGGGGATAGGTGGGGGATCGG + Intronic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918215494 1:182389930-182389952 CTGGGATGGAGGTGGGAAGTAGG - Intronic
918612784 1:186512010-186512032 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
919883008 1:201913095-201913117 CTGGGCCAGAGGTGGGAAGCTGG + Intronic
920054387 1:203181847-203181869 GTGGGGGTAAGGTGGGCTGTAGG - Intronic
920103758 1:203535660-203535682 TTAGGGAAAAGGTGGGAAGCAGG - Intergenic
920534203 1:206726991-206727013 CAGAGGGAAACGTGGGAAGCAGG - Intronic
920732769 1:208503386-208503408 CTGGGAGCAAGGAGGGGAGTTGG + Intergenic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922776408 1:228216084-228216106 GAGGGGGAAAGGAGGAAAGTGGG - Intronic
922889757 1:229052582-229052604 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923523308 1:234752803-234752825 ATGGAGGGGAGGTGGGAAGTAGG + Intergenic
923659483 1:235945918-235945940 CTGGGGGAGAGTAAGGAAGTGGG + Intergenic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
923996811 1:239504907-239504929 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
924395566 1:243616200-243616222 TTGGGGGAAAGGATGGAAGCAGG - Intronic
924906920 1:248464938-248464960 TTGGGGGAAAGGGTGGAAGCAGG + Intergenic
1063655772 10:7986958-7986980 CTGGGGGAAGGGTGAGATGTGGG - Intronic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1063715550 10:8522859-8522881 ATGGGAGGAAGGTGAGAAGTGGG + Intergenic
1064282869 10:13967377-13967399 TCGGGGAAAGGGTGGGAAGTAGG + Intronic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064556713 10:16553845-16553867 TTGGGGAAAGGGTGGGAAGTGGG - Intergenic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065079494 10:22113476-22113498 TTGGGGGAAAGGGTGGAAGGGGG - Intergenic
1065543081 10:26789771-26789793 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
1065651790 10:27899859-27899881 CTGGGGGAAGGGGTGGCAGTGGG + Intronic
1066048598 10:31615916-31615938 CTGGGGGAAAGGTAGGCAGGTGG + Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066346316 10:34590387-34590409 CAAGGGAAAAGTTGGGAAGTAGG - Intronic
1067037665 10:42932105-42932127 CTGGAGGAAAGGTGGTCATTGGG + Intergenic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1068177309 10:53477899-53477921 TTGGGGGAAAGGGTGGGAGTGGG - Intergenic
1068279470 10:54850434-54850456 CAGGGGAAAGGTTGGGAAGTGGG - Intronic
1068363139 10:56007073-56007095 CGGGGGAAAGGATGGGAAGTGGG - Intergenic
1068770167 10:60811850-60811872 CTGCGGGAAAGTTGGGGAGAAGG + Intergenic
1068840299 10:61605947-61605969 CTGGGGAAAATGTGGGCATTTGG + Intergenic
1068983178 10:63082957-63082979 TTGGGGGAAAGGGTGGGAGTGGG + Intergenic
1069093423 10:64229543-64229565 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069456030 10:68554657-68554679 CTGGGGGATAGCGGGGAAGCTGG - Intergenic
1069652798 10:70062873-70062895 TCAGGGGAAAGGTGGGAAGAGGG + Intronic
1069734805 10:70646915-70646937 TTGGGGGAAAGGGTGGGAGTGGG + Intergenic
1069800778 10:71080306-71080328 CAGGGACAAAGGTGGGGAGTGGG - Intergenic
1069838784 10:71326486-71326508 CTGGCAGAAAGCTGGGACGTTGG - Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070421392 10:76241105-76241127 TTGGGGGAAAGGTGGGTGGGTGG + Intronic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072926408 10:99620598-99620620 AAGGGGAAAAGGTGGGATGTAGG - Intronic
1073147448 10:101290145-101290167 CCTGGGGACAGGTAGGAAGTGGG - Intergenic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073348472 10:102802009-102802031 TGGGGGGAAGGGTGGGAAGGTGG - Intronic
1073576396 10:104629624-104629646 GATGGGGACAGGTGGGAAGTGGG + Intergenic
1073698181 10:105893974-105893996 CTGGGGGAAGGGTTGGATGTGGG + Intergenic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1073867150 10:107818210-107818232 CTGGGGGCCAGGTGGGGAGCAGG + Intergenic
1074056494 10:109926854-109926876 AATGGGGAAAGGAGGGAAGTAGG - Intergenic
1074326410 10:112455389-112455411 AAGGGGGAAAGGGGGGAAGGAGG - Intronic
1074347852 10:112705587-112705609 CTGGGCAAAACGTGGAAAGTGGG - Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1075576359 10:123580557-123580579 CTGGGGCAATGGGAGGAAGTTGG - Intergenic
1075872336 10:125779888-125779910 GTGGGGGAAAGGTGGGACCTGGG + Intergenic
1076017820 10:127042517-127042539 CTGGGGGCAAAGTGGGTATTTGG + Intronic
1076069216 10:127472931-127472953 CTGGGTGAAATGTGGGCTGTTGG + Intergenic
1076091543 10:127690421-127690443 CATGGGGGAAGGTGGGAAGAAGG + Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076298701 10:129407274-129407296 CTGGAGGAGAGGTGGAAGGTTGG - Intergenic
1076568178 10:131412949-131412971 CCGGGGGAAAGGCGGGAGATAGG + Intergenic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1076875634 10:133214321-133214343 CTGGGGGAGAGCTGGGAGGGCGG - Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077325263 11:1961025-1961047 TTGCAGGAAAGGTGGGAGGTGGG - Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078519942 11:12054849-12054871 CAGGGGGAAAGGGGGGATATGGG - Intergenic
1078862345 11:15260981-15261003 CTGGGCCAAAGGTGGAAATTAGG + Intergenic
1078923328 11:15851625-15851647 CTGGGAGAAAGGTGGGAGTGAGG - Intergenic
1079152921 11:17917412-17917434 AGGGGGGAAGGGTGGGAAGTGGG + Intronic
1079377831 11:19909561-19909583 CTGGGGAAGAGGTGGGGAGTTGG + Intronic
1079810345 11:24991115-24991137 CAGGTGGAAAGGTAGGAAGCAGG - Intronic
1079862603 11:25692835-25692857 CTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1080202887 11:29693972-29693994 TTGGGGGAAAGGATGGAAGGGGG - Intergenic
1080567883 11:33528820-33528842 CCGGGGGAAAGGTGTGAGGGTGG + Intergenic
1080578615 11:33623123-33623145 CTGGGGCAGGTGTGGGAAGTGGG - Intronic
1081145566 11:39559216-39559238 CTGGGGTAGAGGTGGGAAATAGG - Intergenic
1081239159 11:40681940-40681962 TTGGGGGAAGAGTGGGAGGTGGG + Intronic
1081526307 11:43930110-43930132 CTGGGGGCCAGGTGGGAATCCGG - Intronic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1082650839 11:55790678-55790700 ATGGTGGAAATGTGGGAAATGGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083855160 11:65389637-65389659 CATGGGGAAAGGTGGGACTTGGG + Intronic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084941634 11:72616312-72616334 GTGGGGGAAAGGGGGGCAGTGGG - Intronic
1085027717 11:73246704-73246726 CTGAGGAAAAGGTGGAAGGTGGG - Intergenic
1085407099 11:76269883-76269905 CTGGGGGAAGATGGGGAAGTGGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1086085980 11:82955977-82955999 CTGGGGGAAAGGATGGCTGTGGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086421965 11:86645595-86645617 CTGGGGGAAAGGGTGGCTGTGGG + Intronic
1086429842 11:86725932-86725954 GGGGGAAAAAGGTGGGAAGTGGG + Intergenic
1086960090 11:92972543-92972565 GTGGAGGCAAGGTGGGAGGTAGG + Intronic
1089261061 11:117224340-117224362 ATGGGGGAAAGATTGGAAGATGG + Intronic
1089289251 11:117427938-117427960 CTGGGGGGAAGGTGAGGAGGAGG + Exonic
1089397995 11:118148362-118148384 CTGGGGGAGAGGGGGGAACCAGG + Intronic
1089619336 11:119713527-119713549 CTGGGGTAAGGGTGGGGAGGGGG - Intronic
1089829164 11:121310149-121310171 CTGGGAGAAAGATGGAAACTAGG + Intergenic
1089837951 11:121388115-121388137 AGGGGGAAAGGGTGGGAAGTGGG + Intergenic
1090393076 11:126402083-126402105 TTGGGGGAAAGAGGGGAGGTAGG + Intronic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1090744581 11:129695943-129695965 CTGGGGGAAAGAAGCGAAGTGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1202808244 11_KI270721v1_random:16204-16226 TTGCAGGAAAGGTGGGAGGTGGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091693384 12:2611831-2611853 CTGGGCAAAAGGTGGGGAGGAGG + Intronic
1091787832 12:3253675-3253697 CAGGGTGACAGGTGGGAATTGGG + Intronic
1091879986 12:3969247-3969269 ATGGGGGAAAGGTGGGTGGGAGG - Intergenic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092284597 12:7121501-7121523 CGAGGGGAGAGGTGGGCAGTGGG + Intergenic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092470134 12:8770794-8770816 AAGGGGGTGAGGTGGGAAGTTGG - Intronic
1092829449 12:12429675-12429697 GTGAGGGAAACGAGGGAAGTAGG - Intronic
1093390602 12:18615114-18615136 TGGGGGGAAGGGTGGGAAGTGGG - Intronic
1093396756 12:18692561-18692583 CTGGAGGAAAGGTGCTAGGTGGG + Intronic
1093604043 12:21068189-21068211 CTCGGGAAAGGGTGGGAGGTGGG - Intronic
1093743953 12:22718811-22718833 CTGAGGGAAAGGTGGCACTTGGG - Intergenic
1095445781 12:42280786-42280808 CTGGGGGTAAAGTGGAAAATGGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095929351 12:47610101-47610123 CTGGGGCAAAGGTTGCATGTTGG - Intergenic
1096648554 12:53050847-53050869 TTGGGGCAAGGCTGGGAAGTTGG - Intronic
1097210936 12:57369126-57369148 CTGGGGTAGGGGTTGGAAGTGGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097687085 12:62701267-62701289 CTAGGGCAAAGGTGGGAAAGGGG - Intronic
1097982197 12:65745737-65745759 CTGGGGGAAAATGGGAAAGTCGG - Intergenic
1099014754 12:77331000-77331022 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1099550984 12:84043352-84043374 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1099572197 12:84337078-84337100 CTGGGGGAAAGGTCTTATGTAGG - Intergenic
1100000347 12:89827190-89827212 TTGGGGGAAAGGGTGGAAGGGGG + Intergenic
1100386749 12:94110914-94110936 CCGGGGTACAGGTGGGAAGAGGG - Intergenic
1100408751 12:94294187-94294209 CTGTGGGACAGATGGGAGGTGGG - Intronic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100614342 12:96219589-96219611 TAGGGGGACAGGTGGGCAGTGGG - Intronic
1100857992 12:98775348-98775370 CTGGGGGAAAGTTGCAAAGGAGG + Intronic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1101776856 12:107803430-107803452 CTGGGGGATAGATGGGGAATAGG + Intergenic
1101807221 12:108074901-108074923 TCGGGGAAAGGGTGGGAAGTGGG + Intergenic
1102057705 12:109909046-109909068 TTGGGGGAAAGGGGAGATGTTGG + Intronic
1102574864 12:113849934-113849956 CTGGAGGAAAGAGGGGAAGAGGG + Intronic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103763047 12:123265109-123265131 TTGGGGAAAATGTGGGAAGGTGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1103963449 12:124623363-124623385 CTGGAGGAGAGGTGGGACGGGGG + Intergenic
1104324173 12:127780282-127780304 TTGGGGGAAAGGAGGTATGTGGG - Intergenic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105597737 13:21855328-21855350 CGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1105623830 13:22094005-22094027 CTGGAGGGAAGGTGGGCAGGTGG + Intergenic
1105662157 13:22508426-22508448 CTGGAGGAAAAATGGGAAGAAGG - Intergenic
1105681234 13:22729283-22729305 CTGGGGGAAAGGGTGGGAGAGGG + Intergenic
1105811584 13:24000823-24000845 CTGGGTGAGAGGTGTGAATTTGG + Intronic
1105985730 13:25564856-25564878 TTGGGGGAAGGGTGGGAGGGAGG - Intronic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106306650 13:28517035-28517057 CTGGGGGAAAGGGTGGGAGGAGG + Intergenic
1106381969 13:29248240-29248262 CTTGGGGAAGGGTGGGAGGGGGG + Intronic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1106612250 13:31295410-31295432 CTGGGGGAAGGGGTGGCAGTGGG - Intronic
1106991924 13:35429768-35429790 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107021020 13:35751698-35751720 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107916453 13:45157026-45157048 CTGGGAATAAAGTGGGAAGTAGG + Intronic
1108103684 13:46985528-46985550 CTGTGGGAAACGTGGGCAGTAGG + Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110037602 13:70708010-70708032 TTGGGGGAAAGATTGGGAGTGGG + Intergenic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112879134 13:104084667-104084689 TTGGGGGAAGGGTGGAAAGGGGG - Intergenic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113307309 13:109092570-109092592 GAGGGAGAAAGGTGGGAAGAGGG + Intronic
1113912361 13:113849031-113849053 GTGGGAGAGAGGTGGGAAGGAGG - Intronic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1114583163 14:23784186-23784208 CTGGGGGAAAAGGGGGAATCTGG + Intergenic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1114952374 14:27771409-27771431 AAGGGGAAAAGGTGGGAAGGGGG + Intergenic
1115013273 14:28577013-28577035 CAGGGGGAAAGGTGGGAGGGAGG + Intergenic
1115206138 14:30907459-30907481 CTTGTGGAAAGGTGGGGAGGAGG - Intronic
1115350180 14:32385555-32385577 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1116125403 14:40777618-40777640 TTGGGGGAAAGGGTGGAAGTGGG + Intergenic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116757956 14:48971425-48971447 CTGGGGGAAAGTTGTCAAATAGG + Intergenic
1117096343 14:52302475-52302497 GTGGGGGAAAGGGCGGGAGTGGG - Intergenic
1117640444 14:57792770-57792792 CAAGGGGAAAGGTGGGAGGGGGG + Intronic
1117704670 14:58452124-58452146 GTGGGGAAAGGGTGGGAAGCGGG + Intronic
1118420887 14:65602123-65602145 CGGGGGAAATGGTGGGAAGGAGG - Intronic
1119149479 14:72345161-72345183 CTCTGTGAAAGGTGGGAAGGAGG - Intronic
1119182144 14:72612527-72612549 GTGGGGTGGAGGTGGGAAGTGGG - Intergenic
1119601884 14:75982255-75982277 CTGGGGGAAAGGGAGGGAGGGGG - Intronic
1119705491 14:76780249-76780271 CTGAGGGACAGCTGGGAACTGGG + Exonic
1119803053 14:77462619-77462641 CTGGGTGAAAGATGAGAAGTAGG - Intronic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120662714 14:87269809-87269831 CTGGGGTTAAGGTTGGAAATAGG + Intergenic
1121034707 14:90691597-90691619 AGGAGAGAAAGGTGGGAAGTGGG + Intronic
1121109664 14:91303617-91303639 CAGGGGGAAAGGTGGGGCCTGGG - Intronic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121516079 14:94550825-94550847 TTGAGGGAAAGGTGGGAGGGGGG - Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1122061289 14:99138382-99138404 CTGGTGCAAAGGTGGGGAGAGGG - Intergenic
1122375139 14:101252276-101252298 CCGGGGGACAGGCAGGAAGTGGG + Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1124369775 15:29097805-29097827 CTGGGGCAAAGGAGTGAAGGGGG - Intronic
1124682090 15:31740430-31740452 GTGGGGGGAGGGTGGGAGGTGGG + Intronic
1124831153 15:33150844-33150866 CTGGGAGAAAGGTGGGAGTTGGG + Intronic
1125577592 15:40766086-40766108 GTGGGGGAGAGGGGGGATGTTGG - Exonic
1126321597 15:47430175-47430197 TTGGGGGAATGATGTGAAGTGGG - Intronic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1127810698 15:62562690-62562712 GAGGGGAAAGGGTGGGAAGTGGG - Intronic
1128145943 15:65332650-65332672 CGGGGGAAAGGGTGGGAAGTGGG - Intronic
1128550283 15:68593947-68593969 TTGGGGGAAAGGGAGGAACTAGG + Intronic
1128965820 15:72056584-72056606 TGGGGGAAAAGGTGGGAGGTGGG + Intronic
1129334040 15:74842002-74842024 CTGGGGGAGGGGTGGGATGGTGG + Intronic
1129335300 15:74848588-74848610 CTGGGGGACAGGTGAGACCTGGG - Exonic
1129468727 15:75738540-75738562 CTGGGGGCACGGCGGGGAGTCGG + Intergenic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129739254 15:77982039-77982061 CTGCGGCAGAGGTGAGAAGTGGG + Intergenic
1129846700 15:78771150-78771172 CTGCGGCAGAGGTGAGAAGTGGG - Exonic
1129881712 15:79011055-79011077 AGGGGTGATAGGTGGGAAGTGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130562609 15:84970452-84970474 CAGGAAGAAAAGTGGGAAGTAGG + Intergenic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130961190 15:88659632-88659654 CTGGGGGACAGTGGGGAAGCAGG - Intergenic
1131035940 15:89222018-89222040 CTGGGGGAGGGGTGGGCAATAGG - Intergenic
1131300932 15:91199275-91199297 CTGGGGGAAGGATGGAAATTAGG + Intronic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1132095556 15:98981914-98981936 CTGGGGGCCATGTAGGAAGTAGG + Intronic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1132504514 16:300687-300709 CCGGGGGACAGGTGGGTGGTGGG + Intronic
1132655908 16:1041573-1041595 CTTGGGGAAAAGTGGGAGCTTGG - Intergenic
1132997021 16:2828769-2828791 CTGGGGGATGGGTGTGCAGTGGG + Intergenic
1133093767 16:3426730-3426752 CTGGGGGTAAACTGGGAACTGGG + Intronic
1133387659 16:5383279-5383301 GTGGGGAAAAGGTGGGCTGTGGG + Intergenic
1133523203 16:6578881-6578903 TTGGGGGAAAGGGTGGGAGTGGG + Intronic
1133604826 16:7376472-7376494 CTGGGAGAAAGATTAGAAGTTGG + Intronic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1134409373 16:13991347-13991369 CGAGGGGAAGGGTGGGAGGTGGG + Intergenic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1136360699 16:29777805-29777827 CTGGGTGACAGGTGGCAAGCTGG - Intergenic
1137708345 16:50549765-50549787 CTGGGGGAAAGGTCCTAGGTGGG + Intronic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138635979 16:58338781-58338803 GTTGGGGAAGGGTGGGAAGGAGG - Intronic
1138695586 16:58810011-58810033 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1138759001 16:59520529-59520551 CTGGGGAAAAGGTGGCAATGAGG + Intergenic
1139061257 16:63254418-63254440 CGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1139558739 16:67728709-67728731 CTGGGGCAAGGGTGGGAATCAGG - Intronic
1139669028 16:68479211-68479233 CTGGGAAAAAGGTTGGAAATTGG - Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140352869 16:74279515-74279537 TTGGGGGAAGGGATGGAAGTGGG + Intergenic
1140710964 16:77677238-77677260 CTGGGAAAAAGCTGGGAAGTGGG - Intergenic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141928453 16:87184568-87184590 GTGCAGGAAAGGTGGGGAGTGGG + Intronic
1142281079 16:89147822-89147844 TTGGGGGACTGTTGGGAAGTAGG - Intronic
1142485825 17:247178-247200 CGTGGGCAAAGGTCGGAAGTGGG + Exonic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142663318 17:1446513-1446535 CTGGCGCAAAGGTAGGAAGCAGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143102743 17:4513319-4513341 TGGGGGGGAAGGTGGGAGGTGGG - Intronic
1143418190 17:6765769-6765791 TAGGGGGCAAGGTGAGAAGTAGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143624944 17:8104296-8104318 CAGGGGGAAAGTGAGGAAGTAGG + Intronic
1143740531 17:8949760-8949782 GCAGGGGAAAGGTGGGAAGTGGG + Intronic
1144124957 17:12194631-12194653 ATGGGGAAAGGGTGGGAAGCAGG + Intergenic
1144631527 17:16875078-16875100 ATAGAGGAAAGGTGGGCAGTGGG + Intergenic
1145045707 17:19614038-19614060 TTGGGGGATAGGTGGGACATGGG - Intergenic
1145781983 17:27569419-27569441 CTGGGGGTTAGGTGGGGAGGTGG + Intronic
1145921116 17:28610858-28610880 TTGGGGCAAAGGTGGGAATAAGG + Intronic
1146150104 17:30460656-30460678 TTTGGGAAAAGGTGGTAAGTTGG + Intronic
1146437306 17:32862082-32862104 TTGGGGGAGAGGTGGGGAGCGGG - Intronic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1146928602 17:36762156-36762178 CTGGGGGAAAGGGGTGGGGTGGG + Intergenic
1147704224 17:42414923-42414945 GTGGGGGAAAGGAGGGGTGTTGG - Intronic
1147996123 17:44361351-44361373 CCAGGAGACAGGTGGGAAGTGGG + Intronic
1148155775 17:45424662-45424684 GTGGGGGAAGGGTGGGAGGGGGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148616272 17:49002766-49002788 TTGGAGGAAAGGTGGAAACTGGG + Intronic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149022644 17:51987370-51987392 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1149467499 17:56891551-56891573 CTGGCGGGAGGGTGGGAGGTGGG - Exonic
1150387465 17:64773329-64773351 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150790122 17:68196512-68196534 CGGGGGTTGAGGTGGGAAGTGGG + Intergenic
1150875624 17:68967169-68967191 AAGGGGGAAAGGTGGGAAGGGGG - Intergenic
1151240539 17:72754288-72754310 CTTGGGAAAGGGTGGGAAGGGGG + Intronic
1151319313 17:73343081-73343103 CTGGAAGCAAGGTGGGGAGTGGG + Intronic
1152280121 17:79380188-79380210 CTGGGGGAGGGGTGGCAAGGGGG - Intronic
1152535275 17:80947236-80947258 CTGGGAGAAAGGGGAGAAGCTGG + Exonic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1154492103 18:14930344-14930366 CTGGGAGGAAGGTGGGTGGTGGG + Intergenic
1154966167 18:21358681-21358703 TTGGGGGAAAGGTTGGGAGTGGG + Intronic
1155535154 18:26809316-26809338 CTGGGGGCAAGGTGGAGAGTAGG + Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155937812 18:31772373-31772395 CCGGGGGAAGGCTGGGAAGGGGG + Intergenic
1156321240 18:36025418-36025440 CTGGGGGAAAAGGGGGTTGTGGG + Intronic
1156466933 18:37353642-37353664 CTGGGGGAAAGGTGGGGGACTGG + Intronic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1156958282 18:42993698-42993720 CTGGGGGAAAGGTGGCAATGAGG - Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1157697042 18:49731103-49731125 CTGGGGCAAAGGTAGGAACTAGG + Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157741361 18:50096333-50096355 GAGGGGGAAAGGGGGGAATTTGG - Intronic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1158073859 18:53505809-53505831 GTGAAGGAAAGGTGGGCAGTAGG + Intronic
1158235073 18:55303199-55303221 CTGGGAGCCAGGTTGGAAGTAGG - Intronic
1158395410 18:57075492-57075514 ATTGGGGAAAGGGAGGAAGTTGG + Intergenic
1158433542 18:57415828-57415850 CAGGAGGCAAGGTGAGAAGTTGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159562245 18:70007802-70007824 CTGGGGGAAAGGGCGGCTGTGGG + Intronic
1159907059 18:74102948-74102970 AAGGGGAAAGGGTGGGAAGTGGG + Intronic
1160146877 18:76372184-76372206 TTGGGGAAAAGGTGGGACTTGGG - Intronic
1160409839 18:78667950-78667972 CTAGGGGAGAGGTGGGAGGGTGG - Intergenic
1160466602 18:79083000-79083022 CTGGGGGAAGGGTAGGTTGTGGG - Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1161340567 19:3739738-3739760 CTCTGGGAAAGGTGGAAAATTGG - Intronic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161668470 19:5590895-5590917 CTGGTGGAGAGGTGGGAGGTGGG - Intronic
1161816220 19:6501707-6501729 CTGGGGGAGAGGTGGCAGCTAGG - Intronic
1161825872 19:6564888-6564910 CTGGGCAATAGCTGGGAAGTGGG - Intergenic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162490307 19:10987534-10987556 CTGGGTGAAAGGTGGGAGATGGG + Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164528527 19:29029479-29029501 CAGAGGGAAACGTGGAAAGTGGG + Intergenic
1164549407 19:29196336-29196358 GTTGGGGGCAGGTGGGAAGTAGG - Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164893047 19:31841173-31841195 TTAGGGGGAGGGTGGGAAGTGGG - Intergenic
1165053088 19:33155611-33155633 TTGGGGGAAAGATGGGGAGCAGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165149634 19:33753381-33753403 GTAGGGGGAAGGTGGGAAGTTGG - Intronic
1165420794 19:35721050-35721072 CTGGGGAACAGGTGGGGAGGTGG - Exonic
1165693178 19:37879703-37879725 CTGGGAGAAAGATGGGAGGCTGG + Intergenic
1165987505 19:39783026-39783048 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1166151902 19:40880950-40880972 ATGGAGGAAGGGTAGGAAGTGGG + Intronic
1166235361 19:41451793-41451815 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1166246708 19:41533146-41533168 CTCGGGGAAAGGTTGGGAGGGGG - Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166338437 19:42122670-42122692 CTGGGGGTAAGGGGGGAATTTGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166664100 19:44666801-44666823 GTGGGGGCAATGTGGGAGGTGGG + Intronic
1166732422 19:45066739-45066761 TTGGGGGACAGGTGGGACCTGGG + Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1167044733 19:47042911-47042933 CAGGGGCCAAGGTGGGAGGTGGG - Intronic
1167105634 19:47428737-47428759 CTGGGGGAGAGAAGGGTAGTGGG + Exonic
1167377400 19:49119395-49119417 TTGGGGGGAAGGTGGGATTTGGG + Exonic
1167502068 19:49854109-49854131 CTGGGGCAAAGGCTGGAGGTGGG + Intronic
1167766319 19:51485137-51485159 CTGGGACAAGGGTGGGATGTTGG + Intronic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168399436 19:56076297-56076319 CTGAGGCAAAGGTGGGAATGGGG + Intergenic
1168673290 19:58257859-58257881 CTGGGGGAAACGTGAGAGGGTGG - Intronic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
1202699768 1_KI270712v1_random:155430-155452 CTGGGGGAGAGGTCGGAAGTGGG - Intergenic
925036780 2:692986-693008 CTGGGGTAAGTGTGGGAGGTGGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926245818 2:11121897-11121919 TTGGGGTCAGGGTGGGAAGTGGG - Intergenic
926655807 2:15404459-15404481 CAGAGGGAAAGATAGGAAGTGGG - Intronic
926915434 2:17886788-17886810 CTGTGGCAAAGGTGGGTAGGTGG - Intronic
926980448 2:18561761-18561783 ATGGGTGGAGGGTGGGAAGTGGG - Intronic
926982042 2:18583257-18583279 CTGGGGGACAGGTAGAGAGTAGG + Intronic
927433409 2:23046429-23046451 CTGGGGGAAGGGGGAGAGGTAGG - Intergenic
927719140 2:25372095-25372117 CTGGGGTAAGGGTGGGATGTGGG + Intergenic
927969794 2:27298366-27298388 ATGAGGCAAAGGTGGGAAGCAGG + Intronic
928025561 2:27736088-27736110 GAGGGGGAAAGGTGGGGAGCAGG - Intergenic
929018334 2:37524666-37524688 GTGGGGGACAGGTGGAAAGATGG + Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930814815 2:55584493-55584515 TTGGGGAAAGGGTGGGAAGGGGG - Intronic
931995060 2:67831806-67831828 TTGGGAGACAGGTGGGAAGATGG - Intergenic
932597110 2:73101018-73101040 CTGGGAGAAAGGTTGGTGGTGGG + Intronic
932708897 2:74047773-74047795 CTGTCGGACAGGTGGGAAGAGGG - Exonic
932890579 2:75593037-75593059 AGGGTGGGAAGGTGGGAAGTTGG - Intergenic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
934044088 2:88157177-88157199 AGGGGGAAAGGGTGGGAAGTGGG - Intergenic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
934484938 2:94697907-94697929 AAGGGGAAAAGGTGGGAAGGGGG - Intergenic
934702786 2:96455243-96455265 CTGGGGGAAGGGGTGGCAGTGGG + Intergenic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
935785838 2:106548084-106548106 GAGGGGGAAAGGTGGGACGAGGG - Intergenic
936063584 2:109313829-109313851 GTGGGGGAGAGGAGGGAGGTGGG + Intronic
936607539 2:113973287-113973309 CTGGAGGATAGGTTGGAAGCGGG + Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936695046 2:114936136-114936158 TTGGGGAAAGGGTGGGAAGCAGG - Intronic
937059447 2:118970677-118970699 CTGGGGGAAAGGTGGTGACTTGG + Intronic
937145029 2:119637236-119637258 CTGGGGCAAAGGTAGGGAGAGGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937796634 2:126030335-126030357 CTGGTGGAAAACTGGGCAGTGGG - Intergenic
937807334 2:126161317-126161339 CTGGGGGAAGGGGTGGATGTGGG + Intergenic
938025285 2:127942342-127942364 CGGGGGGAAACGGGAGAAGTAGG + Intronic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
939034719 2:137116989-137117011 CAGGGGGAAAGGCTGGATGTGGG + Intronic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
939358180 2:141131982-141132004 CTGGGGCAAGAGTGGGAAGGGGG - Intronic
939859948 2:147407139-147407161 AGTGGGGACAGGTGGGAAGTGGG + Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
940963881 2:159816293-159816315 CTAGAGGAAAAGTGGGAAGAAGG + Intronic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941758329 2:169212764-169212786 TTGGGGGAAGGGTGGGAGGGGGG + Intronic
941859781 2:170267143-170267165 CTGGGGGTAGGGTGGGAATTGGG + Intronic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943996229 2:194769481-194769503 TTGGGGAAAGGGTGGGAAGCGGG - Intergenic
944261818 2:197686191-197686213 GTGGGGGAAAGGTGGGAGGTGGG - Intergenic
944386223 2:199167927-199167949 GAGGGGCAAAGGTGGGGAGTGGG + Intergenic
944386574 2:199171502-199171524 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
944551807 2:200851044-200851066 CTTGGGGAAGGGTGGGAGGGAGG - Intergenic
944931529 2:204525248-204525270 CTGGGGATAAGTGGGGAAGTGGG + Intergenic
945045074 2:205774708-205774730 CTGGGGAATAGGTGGGAGGTGGG - Intronic
945207279 2:207345002-207345024 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
945409228 2:209488833-209488855 CTGGGGAAAGGGGGGGATGTGGG + Intronic
945409842 2:209495230-209495252 CTGGGGGAAGAGGGGGATGTGGG + Intronic
945828697 2:214756823-214756845 AAGGGGAAAAGGTGGGAAGGTGG + Intronic
946029236 2:216691940-216691962 GTGGGGGAGAGGAGGGAGGTAGG + Intronic
946249032 2:218401971-218401993 CAGGGGCAAAGCTGGGAAGGGGG + Intronic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
946897386 2:224338425-224338447 CTGGGATAAAGGTGGGATCTGGG - Intergenic
947437292 2:230083655-230083677 CTGGGGGAGGGGGGTGAAGTGGG - Intergenic
947681365 2:232037131-232037153 CTGGGGGAAGGGGCGGATGTGGG - Intronic
947691571 2:232141692-232141714 CTGTGGTAGAGATGGGAAGTAGG + Intronic
948418454 2:237835858-237835880 CTGAGGGAAAGGGTGGGAGTGGG - Intronic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948863697 2:240764883-240764905 CTCGGGGCAGGGTGGGAACTTGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169755905 20:9043001-9043023 GTGGGGGAAAGGCTGGGAGTGGG + Intergenic
1170109985 20:12794762-12794784 GTGGGTGAAGGGTAGGAAGTAGG - Intergenic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170317688 20:15060563-15060585 CTGGGGGAAAGTTGGAAGATGGG - Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1171041181 20:21765150-21765172 AGGGGGAAATGGTGGGAAGTGGG - Intergenic
1171215565 20:23350109-23350131 CTGGGGCGAGGGTGGGACGTGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171510842 20:25683354-25683376 CTGGGGGAAATGGGGGAAGGAGG + Intronic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172182975 20:33014880-33014902 CTGGGGGGGAGGTGGGAGGGTGG - Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172602250 20:36191921-36191943 GTGGCTTAAAGGTGGGAAGTGGG + Intronic
1173222029 20:41138412-41138434 CTGGGGGAGAGGGAGGAAGGTGG + Intronic
1173480932 20:43398815-43398837 GTGGGTGAAAGTTAGGAAGTGGG - Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173947802 20:46965464-46965486 CTTGGGCAAAGGTGGGGGGTTGG + Intronic
1174037478 20:47677179-47677201 CTGGGGGAACGGGGGGTCGTGGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174268706 20:49351225-49351247 TGCGGGGCAAGGTGGGAAGTGGG - Intergenic
1174281779 20:49445011-49445033 TCTGGGGAAAGGTGGGAAGAGGG - Intronic
1174468970 20:50741406-50741428 ATGTGGTAAAGGTGGGAAGGTGG - Intronic
1174967873 20:55239802-55239824 CTGGGGGAAAGGAGGGGAAGGGG - Intergenic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175371443 20:58495683-58495705 TTGGGGGAAAGGGGTGAGGTGGG + Intronic
1175505798 20:59483307-59483329 CTGGGGAGAAAGTGGGAAGGGGG + Intergenic
1175572692 20:60036379-60036401 CTGGGGGAAGGGTGGCAATGGGG - Intergenic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175722491 20:61295717-61295739 CTGGGGAAAAGCGGGGAAGGAGG + Intronic
1176263334 20:64194750-64194772 CTGGGGGCAAAGGTGGAAGTTGG + Intronic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1177405595 21:20663513-20663535 TTGGGGGGTAGGTGGGAAGGAGG - Intergenic
1177716476 21:24845895-24845917 TTGGGGGAAAGGGTGGGAGTAGG - Intergenic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178793892 21:35725295-35725317 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1178812303 21:35895388-35895410 CTGGGGGAAAGGGTGGGAGGGGG + Intronic
1179054285 21:37916710-37916732 CTGGGAGAAAGGTTGGGACTGGG - Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181002284 22:19993495-19993517 CTGGGGGAAGGCTAGGAAGGGGG + Intronic
1181039775 22:20186493-20186515 CTGGGGAAACTGTGGAAAGTAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181512482 22:23395089-23395111 CTGGAGGGCAGGTGGGATGTGGG - Intergenic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181883840 22:26003150-26003172 CAGGGGCAAAGGTTGGAAGTGGG + Intronic
1182101994 22:27663920-27663942 CTGGTGGAAAGGTGAAAGGTGGG + Intergenic
1182353486 22:29711534-29711556 GTGGGGGACAGGTGGGAGCTGGG + Intergenic
1182457299 22:30460143-30460165 CTGGGGGACAGATGGAAAGAGGG + Intronic
1182512751 22:30830633-30830655 CTGGGGGACAGGTGAGGAGTGGG - Intronic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182885266 22:33768393-33768415 CTTGGGTAAAGGTGTGCAGTAGG - Intronic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183366429 22:37409451-37409473 CTTGGGGAAAGGTAGGGTGTGGG - Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1183878611 22:40806186-40806208 CAGGGGGAAAGCTGTGAAGTGGG + Intronic
1183918580 22:41144777-41144799 ATGGGGCAAATGTGGGCAGTAGG + Intronic
1183951285 22:41354481-41354503 CTGGGGACACGGTGGGGAGTAGG + Intronic
1184103360 22:42353366-42353388 TTGGGGGAAGGGTGAGAAGAGGG + Intergenic
1184368153 22:44065621-44065643 TTGGGGAAAGGGTGGGAGGTAGG - Intronic
1184471020 22:44696428-44696450 CTGGCTGACAGGTGGGAAGGTGG + Intronic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1185415084 22:50705353-50705375 CTGGGGGAACGCCGGGAAGGAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949109330 3:239751-239773 TTGGGGGAAAGGGTGGGAGTGGG - Intronic
949321534 3:2816422-2816444 TAGGGGGAAGAGTGGGAAGTGGG + Intronic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
949377713 3:3408115-3408137 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949840099 3:8311112-8311134 GTGGGGGGAAGGTGGGAGATGGG - Intergenic
949921390 3:9005751-9005773 CTGGGAGAAATGTGGGGGGTAGG + Intronic
950134479 3:10571096-10571118 GTGGGGGAAAGGTGGAAGTTTGG + Intronic
950143325 3:10630307-10630329 GTGGGTGGAAGGTGGGAAGAGGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950588445 3:13915331-13915353 TTGGGGGAAGGGTGGAAGGTGGG + Intergenic
950674783 3:14548160-14548182 CTGGGCAGAGGGTGGGAAGTGGG + Intergenic
950859092 3:16131759-16131781 GTGGGGTAAAGGTGGAAAGCAGG - Intergenic
951508277 3:23473578-23473600 GTGGGGAAAGGGTGGGAAGGGGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953039100 3:39238995-39239017 GAGGGAGAAAGGTGGGAAGAGGG - Intergenic
953040911 3:39253933-39253955 CTGTGGTATAGGTGGGAAGGTGG + Intergenic
953568664 3:44054296-44054318 CTGGGAGAAAGGTAGACAGTAGG + Intergenic
953726021 3:45399785-45399807 TTGGGGGAAGGGTGGAAAGGGGG - Intronic
954479271 3:50782781-50782803 TGGGGGGAAGGGTGGGAGGTGGG - Intronic
954492796 3:50922914-50922936 TCGGGGAAAAGGTGGGAAGGGGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954851421 3:53604193-53604215 TTGTGTGAAAAGTGGGAAGTGGG + Intronic
955060754 3:55489642-55489664 CTGGGGGAAAGAAAGCAAGTTGG - Intronic
955148887 3:56347397-56347419 CTGGAGGAAAGCTGGGAGGCTGG + Intronic
955598695 3:60620885-60620907 CTGGGGGAGTGGTGGGGCGTAGG + Intronic
955740523 3:62086380-62086402 CTGGGGTTAGGGTGGGAATTTGG - Intronic
956224710 3:66944316-66944338 TGGGGGAAAGGGTGGGAAGTGGG + Intergenic
956299249 3:67751869-67751891 TGGGGGGAAGGGTGAGAAGTGGG + Intergenic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956528604 3:70192148-70192170 TTGGGGGAAAGGGGGTAAGTGGG - Intergenic
956694491 3:71906924-71906946 TAGGGGGAAAGGGGGGAAGGAGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
957160936 3:76608918-76608940 CTCGGGGAAAGGTTGGGAGGAGG - Intronic
957373645 3:79328794-79328816 CTGGGTGAAAGATGGGAGGGGGG - Intronic
957602019 3:82349500-82349522 TTGGGGGAAAGGGTGGGAGTGGG - Intergenic
957763934 3:84596371-84596393 TTGGGGGAAGGGTGGGAGGCGGG - Intergenic
957866395 3:86029459-86029481 GGGGGGAAAAGGTGAGAAGTAGG + Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958092539 3:88894849-88894871 TTGGGGGAAAGGTGGGAGAGGGG - Intergenic
958531038 3:95330370-95330392 CTGGGGGGCAAGTGGGAAGTGGG - Intergenic
958979145 3:100699909-100699931 TTGGGGGAAAGGGGAGATGTTGG + Intergenic
959033902 3:101337263-101337285 CTGGGGGAAATCCTGGAAGTTGG - Intronic
959231075 3:103652414-103652436 CTCGGGAAAAGGTAGAAAGTTGG - Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960033013 3:113073736-113073758 TTGGGGGAAAGGGTGAAAGTGGG - Intergenic
961087838 3:124084355-124084377 TTGGGGCAAAGTTGGGAATTCGG - Intronic
961282969 3:125777958-125777980 CTGGGGGGACGGTGGGGTGTGGG - Intergenic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961518746 3:127455152-127455174 CCTGGGGAAAGGGGGGAGGTTGG - Intergenic
962133008 3:132702430-132702452 CTGGGGAAAACTTGGGAAATAGG - Intronic
962298604 3:134216429-134216451 ATGGGGTAAGGGTGGGTAGTGGG + Intronic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962680608 3:137796066-137796088 CTGGGGTCGGGGTGGGAAGTAGG - Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963049876 3:141132127-141132149 CTGGGGGAAAGGGTGGGAGGGGG - Intronic
963179953 3:142344097-142344119 GGGGGGGAGGGGTGGGAAGTGGG + Intronic
963353923 3:144186459-144186481 CTGAGAAGAAGGTGGGAAGTGGG - Intergenic
963849689 3:150198519-150198541 GTGGGGGAGAAGTGGGGAGTGGG + Intergenic
963874600 3:150461274-150461296 CTGGGGGAAGGGTTGACAGTAGG - Exonic
964129464 3:153270678-153270700 CTGGCAAAAAGGTGGGATGTTGG + Intergenic
964209636 3:154212603-154212625 CTGGGGGGTAGGTGGGTGGTAGG + Intronic
964310215 3:155384513-155384535 GTGGGGGGAAGGTGGTCAGTGGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
964985266 3:162731168-162731190 CTCGGGGAAGGGTGGGAGGGGGG - Intergenic
965991087 3:174818836-174818858 CAGGGGGAAAGGGAGGGAGTGGG + Intronic
966007747 3:175037188-175037210 CTGGAGGACAAGTGGGAAGCTGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966399490 3:179534216-179534238 CTGGGGGCAAGGGTAGAAGTGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967044304 3:185722543-185722565 ATGGTGGGAAGGTGGGAAGGTGG + Intronic
967331651 3:188296172-188296194 CTGGGGGAAGGATGAGAAGGAGG + Intronic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
967825934 3:193877353-193877375 CTGGGGAGAAGGTGGGCAGGAGG + Intergenic
967967480 3:194973526-194973548 CTGGGGGAAAGGCATGAAGCTGG - Intergenic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
968728697 4:2259915-2259937 CTGGGGCAAGGGTAGGGAGTGGG - Intronic
968829046 4:2922732-2922754 CTGGGGGAAGGGTTGGCTGTGGG - Intronic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969301658 4:6300634-6300656 CTGGGGGAAAGATGGTACGTGGG - Intronic
969680654 4:8641522-8641544 CTGGGAGAAAGGTGGGCGGCAGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970736570 4:19176994-19177016 CTAGGGGAAATGTGGGCAGAGGG - Intergenic
971172464 4:24247908-24247930 GTGGGGGAAAGCAGGGCAGTGGG - Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972255831 4:37354440-37354462 CTGGGGGAAGGGGCGGCAGTGGG - Intronic
972372407 4:38437810-38437832 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
972588748 4:40463904-40463926 CGTGGGGATAGGTGGGAAGGTGG + Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
973717263 4:53689545-53689567 ATGGGGGACAGGTGTGAAGTAGG - Intronic
973792102 4:54387486-54387508 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
974251028 4:59383026-59383048 CAGGAGAAAAGGTGGGAAGGGGG - Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
974468601 4:62290673-62290695 CTGGGGGTAGAGTGGGAGGTAGG + Intergenic
974800914 4:66816972-66816994 CTGGGACAGAGGTGGGAAATAGG - Intergenic
975000011 4:69212460-69212482 CTGAAAGAAAGATGGGAAGTAGG - Intronic
975005761 4:69282753-69282775 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975014170 4:69391702-69391724 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975015427 4:69411088-69411110 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975533008 4:75420527-75420549 CTGGGGGAAGGGGTGGATGTAGG - Intergenic
975623812 4:76321999-76322021 TTGGGGGAAGGGTGGGAGGTGGG + Intronic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
976157659 4:82164567-82164589 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
977671444 4:99699615-99699637 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
978126856 4:105146303-105146325 TTGGGGGCGAGGTGGGAGGTTGG - Exonic
978469473 4:109047472-109047494 CGGGGGAAAAGGTGTGAAGGGGG + Intronic
979146711 4:117254912-117254934 CTGGGGAAAAGGTGGCAATGAGG - Intergenic
980806656 4:137824260-137824282 CTGAAGCAAAGGTGAGAAGTCGG + Intergenic
980874331 4:138645760-138645782 CTGTGGAAAAGGTGAGAAGCAGG + Intergenic
981202128 4:141992607-141992629 CTGGGGGAAAGGGTGGTTGTGGG - Intergenic
981522388 4:145676722-145676744 CTGGGGCAATGGTGGGAGGCAGG - Intergenic
981680792 4:147395416-147395438 CAGGGGAAAGGGTGGGAGGTGGG + Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
981830256 4:148991549-148991571 CTGGGGGGTGGTTGGGAAGTGGG + Intergenic
982130908 4:152227891-152227913 CTGAGGGGAAGGTGTGAAATTGG - Intergenic
982157721 4:152537602-152537624 CTGCGGGAAAGGTGGTGAGAGGG + Intergenic
982311805 4:153993887-153993909 TAGGGGAAAAGGTGGGAAGGGGG - Intergenic
982803992 4:159740334-159740356 CAGGGGAAAGGGTGGGAAGTGGG - Intergenic
984526004 4:180860330-180860352 CTGGGGGAAGGGTTGGCCGTGGG - Intergenic
985834543 5:2260934-2260956 CTGGGTGAAAGGTTGGCACTGGG + Intergenic
985950063 5:3216088-3216110 ATGGGGGATAGAGGGGAAGTGGG + Intergenic
986038084 5:3960048-3960070 CAGGGGGAAAGCTGCTAAGTTGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986612137 5:9579707-9579729 CAGGGGAAAGGGTGAGAAGTGGG + Intergenic
986813749 5:11385647-11385669 CTGGGGCAAGGGTGGGGAGTGGG - Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987322482 5:16783564-16783586 ATGGTAGAAAGGTGGGAAGAGGG + Intronic
987348133 5:16996998-16997020 CTCGGGAAAGGGTGGGAAGGGGG + Intergenic
987704568 5:21446612-21446634 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988609792 5:32713280-32713302 TTGGGGGACAGGTGGAAAGAAGG - Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
988999918 5:36749330-36749352 TTGGGGGAAAGGAGAGAAATGGG - Intergenic
989102816 5:37837102-37837124 CGGGGGAAAAGGGGGGAGGTTGG + Intronic
989690287 5:44135403-44135425 CTGGGGAAAGAGTGGGAAGGGGG - Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990614978 5:57498492-57498514 CAAGGGTAGAGGTGGGAAGTGGG + Intergenic
990918205 5:60933721-60933743 TCGGGGGAAAGGGTGGAAGTGGG - Intronic
990950381 5:61292929-61292951 CTTGGGAAAGGGTGGGGAGTGGG - Intergenic
991090065 5:62685674-62685696 CTGGGGGAAAAGCAGAAAGTGGG + Intergenic
991117929 5:62975847-62975869 TTGGGGTAGAGGTGGGAACTGGG - Intergenic
991481967 5:67090399-67090421 ATGGGGGAAAAGTGGGGAGGGGG - Intronic
991553005 5:67863391-67863413 CGGGGGAAAAGGTGGGAAGGGGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992520825 5:77549127-77549149 CAGGGGGAAAGGGGGAAAGGGGG + Intronic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
992825792 5:80548661-80548683 TTGGGGAAAAGGTGGGAAAGGGG - Intergenic
992826513 5:80554672-80554694 AAGGGGGAAAGGTGGGAAAGGGG + Intergenic
993608496 5:90024959-90024981 CAGGGGGAAAGATGGGATGGGGG + Intergenic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994625995 5:102219793-102219815 CTGGGGGAAAGGGTGGGAGAGGG - Intergenic
994722737 5:103399796-103399818 CTGGGGGAGAAGTGGGGGGTGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995767374 5:115633400-115633422 CTTGGGAAAAGGTTGGAACTAGG + Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996021385 5:118594468-118594490 ATGGAGGAAACGTGGGAAGAGGG - Intergenic
996136313 5:119846549-119846571 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
996760918 5:126984932-126984954 CTAGTGGAAAGGTGGGAGCTGGG + Intronic
996865643 5:128118564-128118586 CGGGTGGAAGGGTGGGAGGTGGG + Intronic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997316106 5:132937595-132937617 CTGGGGGGAAGGGTGGTAGTTGG - Intronic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997812771 5:136988405-136988427 CTGGAGGTAAGGTGGGATGGAGG - Exonic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998937099 5:147240906-147240928 CAGTGAGAAAGGTGGAAAGTAGG + Intronic
999338033 5:150740894-150740916 CAGGGGGAAAGCTGGGAAGGGGG + Intronic
999491613 5:152056723-152056745 CTTGGGGCAAGGTGGCAAGATGG + Intergenic
999672386 5:153969130-153969152 CGGGGGGAAAGGTTGGATGCTGG - Intergenic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
999912992 5:156226215-156226237 CAGGGGGAAAGGGCGGGAGTCGG - Intronic
999940688 5:156539406-156539428 TTGGGGGAAAGGATGGAAGGGGG - Intronic
1000215303 5:159149653-159149675 TTGGGGGAAAGGGTGGAAGGGGG - Intergenic
1000438106 5:161238471-161238493 CTGAGGCAAGGGTGGCAAGTTGG + Intergenic
1000568435 5:162881046-162881068 TTGGGGGGAAGGGTGGAAGTGGG - Intergenic
1001155848 5:169271960-169271982 CTGGGGAAAAGCAGGCAAGTGGG + Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001270868 5:170310739-170310761 CTGGGGGTAACGAGGGCAGTGGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002381371 5:178832072-178832094 CTGGGGGAGGGGGGGGAGGTGGG - Intergenic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1002466798 5:179412321-179412343 GTGGGGGAAAGGTGGAAGGTCGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002828642 6:798018-798040 CTGGGGGCTAGGTGGAAAGGAGG + Intergenic
1003269495 6:4594821-4594843 TCGGGGAAAAGGTGGGAAGGGGG - Intergenic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1006045051 6:31288057-31288079 CTGGGGTAAGGCAGGGAAGTGGG + Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1007043093 6:38743550-38743572 CTGGGGGGAAGGGGGAATGTTGG - Intronic
1007071477 6:39041411-39041433 CTGGAGGAAAGGTGGGGAGCTGG - Intergenic
1007112778 6:39322579-39322601 ATGGGGGAGAGGTGGGAAACAGG + Intronic
1007267323 6:40606690-40606712 CTGGGCAAAAATTGGGAAGTTGG - Intergenic
1007299777 6:40858175-40858197 TCAGGGGAAAGGTGGGAAGGGGG - Intergenic
1007411986 6:41669771-41669793 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007767542 6:44169844-44169866 GTGGGAGAAAGGTGGGGAGGGGG + Intronic
1007770679 6:44189600-44189622 CTGGGGGAAATCAGGGCAGTGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007957419 6:45930138-45930160 CTGGGGGGTAGGTGGGGAGGAGG - Intronic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008483087 6:52006837-52006859 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1008542252 6:52555284-52555306 CTGGGGGAGAGGTGGTGGGTTGG - Intronic
1009797893 6:68495269-68495291 CTGGGGGAAAGGGTGGCTGTGGG + Intergenic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1010175621 6:73024869-73024891 CTGGTGGGAAGGTGGGCAGTGGG - Intronic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010464985 6:76157281-76157303 TTGGGGGGAAGGTTGGGAGTGGG - Intergenic
1010783832 6:79976708-79976730 GTGGTGGAGAGGTAGGAAGTAGG - Intergenic
1010976379 6:82319106-82319128 TCTGGGGAAAGATGGGAAGTGGG + Intergenic
1011196756 6:84788478-84788500 ATGGGGAAAGGGTGGGAAGGGGG + Intergenic
1011289590 6:85762858-85762880 CAGGGGAAAGGGTGGGAGGTTGG - Intergenic
1011332702 6:86227960-86227982 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1011698132 6:89931308-89931330 CTTAGGGAAAGGTGGGGAGGAGG + Exonic
1012027777 6:94019901-94019923 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
1012083873 6:94797823-94797845 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1012207907 6:96483904-96483926 AGGGGGAAAGGGTGGGAAGTGGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1012978452 6:105805023-105805045 CTTGGGGGATGGTGGGAGGTGGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014492116 6:122075497-122075519 CCAGGAGAAAGGTGGGAAGAAGG + Intergenic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1015246303 6:131078429-131078451 TTGGGGGAAAGGGTGGGAGTAGG + Intergenic
1015886782 6:137926032-137926054 CTGGGGGTTAGGGAGGAAGTGGG - Intergenic
1015948830 6:138530802-138530824 TTGGGGGAAAGGATGGGAGTGGG + Intronic
1016496591 6:144669732-144669754 CCAGGGGAAGGGTGGGAGGTGGG - Intronic
1016750353 6:147624717-147624739 TGGGGGAAAGGGTGGGAAGTGGG + Intronic
1016753976 6:147663318-147663340 GAGGGGGAAAGGTGGGAGGAGGG + Intronic
1017056290 6:150438992-150439014 CAGGGAGAAGGGTGGGAGGTGGG + Intergenic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1019059047 6:169242688-169242710 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059075 6:169242770-169242792 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059083 6:169242795-169242817 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059106 6:169242861-169242883 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059120 6:169242903-169242925 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059165 6:169243042-169243064 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059182 6:169243092-169243114 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019437300 7:1028672-1028694 ATGGGGGAGATGAGGGAAGTAGG - Intronic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020188309 7:5975227-5975249 CTGGGGGCCACGTGGGGAGTGGG - Intronic
1020254877 7:6497486-6497508 CTGGGAGCGAAGTGGGAAGTGGG + Intronic
1020294608 7:6749541-6749563 CTGGGGGCCACGTGGGGAGTGGG + Intergenic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1020519536 7:9168964-9168986 CTGGGGGAAGGGGCGGCAGTGGG - Intergenic
1020650954 7:10875667-10875689 CTGGGGGAAAGGTGGGGTTGGGG - Intergenic
1020823801 7:13002557-13002579 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1022518025 7:30988022-30988044 CTGGGGCAGAGGTGGGATGCAGG + Intronic
1023061643 7:36333052-36333074 CTGGGGGAAGGGGTGGCAGTGGG + Intronic
1023422376 7:39995533-39995555 CTGGAAGACAGGTAGGAAGTAGG - Intronic
1023488336 7:40710954-40710976 CTGGGGTAAAGGAAGGAATTGGG + Intronic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023669875 7:42564337-42564359 CGGAGGAAAAGGTGGGAAGGTGG + Intergenic
1024104699 7:46071188-46071210 CTTGGGGAAAGCTGGTGAGTTGG + Intergenic
1024284304 7:47744210-47744232 TGGGGGGAAAGGGAGGAAGTGGG - Intronic
1024305279 7:47923380-47923402 AGGGGGAAAGGGTGGGAAGTGGG + Intronic
1024575836 7:50763621-50763643 CTGGGGGAGAGGAGGGATTTGGG - Intronic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024799068 7:53054967-53054989 CTGGGGGAACTGGGAGAAGTTGG + Intergenic
1024983873 7:55179533-55179555 CTGGGGAGAAGGTGGGCAGGAGG + Intronic
1025024605 7:55506105-55506127 CTGGGTGAGAGATGGGAGGTGGG - Intronic
1026444873 7:70475390-70475412 AGGGGGGAAAGGTGGGAATGTGG - Intronic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1028057332 7:86262538-86262560 CTGGGGGCTAGGTGGGCAGTGGG - Intergenic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028784051 7:94772283-94772305 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1028841419 7:95433719-95433741 AAGGGGCTAAGGTGGGAAGTTGG - Intronic
1029053657 7:97717046-97717068 GCGGGGGAAGGGTGGGAAGGGGG + Intergenic
1029205212 7:98865786-98865808 TTGAGGGACAGGTGGGACGTGGG - Intronic
1029421842 7:100476025-100476047 GTGGGGGAAGGCTGGGGAGTAGG + Intronic
1029787293 7:102805525-102805547 GTGGGGGAAAGGTTGGGAGGGGG + Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031001944 7:116425741-116425763 CTGGGGAAGGGGTGGGGAGTGGG - Intronic
1031214595 7:118873943-118873965 CTAGAGGGAAGGTGGGAAGGGGG - Intergenic
1031783716 7:126002309-126002331 CTGGGGTAAGGCTGGGAATTGGG + Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031869330 7:127075164-127075186 CAGGGGTAAAGGTGGGAGATGGG + Intronic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1032891908 7:136205805-136205827 CTGAGAAAGAGGTGGGAAGTAGG + Intergenic
1033277914 7:139986511-139986533 TGGGGGGAGAGGTGGGAAGGGGG - Intronic
1033313582 7:140280123-140280145 ATGGGGGAAAGTTGAGAAGTAGG - Intergenic
1033432786 7:141304423-141304445 CTGGGCAGAAGGTGGGAAGAGGG - Intronic
1033462510 7:141560610-141560632 CAGGGGGAAAGGTGGGAGTGGGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033668960 7:143471492-143471514 TTGGGGTAAAGGAGGGAAGGAGG + Intergenic
1033679541 7:143580520-143580542 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1033692295 7:143748923-143748945 CTGGGGGAAAGGGTGGCTGTGGG + Intergenic
1033943230 7:146681489-146681511 CAGGGAGAAGGGTGGGGAGTGGG + Intronic
1034263487 7:149771199-149771221 CTGGGGGAAATTTGGGAAACTGG + Intronic
1034339031 7:150340697-150340719 CTGGGGGGAGGGTGGGGAGCGGG + Exonic
1034402792 7:150876953-150876975 GTGGGGGAAAGGCGGGGGGTGGG - Intergenic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1035579436 8:730999-731021 CTGGGGTGGAGGTGGGGAGTCGG + Intronic
1036114285 8:5941622-5941644 CTCGGGGAAGGGTGGGAGGTGGG + Intergenic
1036441519 8:8785852-8785874 CTGGGGAAGAGGTGGGGAGGGGG - Exonic
1036480819 8:9137885-9137907 CTGGGAGAAAGACGGGTAGTGGG + Exonic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037357843 8:18041494-18041516 GTGGGGGAAAGGTGAGAGGGAGG - Intergenic
1037542408 8:19885327-19885349 CTGGGGGCAGGGTGGGGACTTGG - Intergenic
1038048356 8:23786394-23786416 CTGGAGGGAAGGTGGGAATGAGG + Intergenic
1038296191 8:26292159-26292181 CGGGGGGCAAGGTGGGGAGGTGG - Intronic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039479211 8:37859265-37859287 CTGGGAGAAGGGTGGGAGGGAGG + Exonic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1039846576 8:41329901-41329923 CAAGGGGAAAGGTGGGAAGGTGG - Intergenic
1040392290 8:46960618-46960640 ATGGGGAAAGGGTGGGAAGGGGG - Intergenic
1040442326 8:47456753-47456775 GTTGGGGAAGGGTGGGAAGTGGG - Intronic
1040529997 8:48259003-48259025 CTGGGGCAAAGGGGAGAATTAGG - Intergenic
1040779953 8:51095515-51095537 CTGGGGGAAAGGGCGGTTGTGGG + Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041250979 8:55934766-55934788 AGGGGGGTGAGGTGGGAAGTGGG - Intronic
1041253847 8:55961883-55961905 CTGGGGGACAGGTAGGGTGTGGG - Intronic
1041365705 8:57101741-57101763 CTGGGGGAAAGAGCGGGAGTGGG - Intergenic
1041487861 8:58398720-58398742 CTGGGGGAAATTTGGGGGGTTGG - Intergenic
1041550556 8:59096016-59096038 GTTGGGGAGAGGTGGGGAGTTGG - Intronic
1042077785 8:65015312-65015334 CAGGGGCAGAGGTGGGGAGTGGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042099771 8:65262432-65262454 CGGGGGGAAGGGTGGAAAGCAGG - Intergenic
1043251966 8:78086355-78086377 GTGGGAGAAAGGTGGGAGGGGGG - Intergenic
1043881168 8:85544708-85544730 GTGGGGGAAGGGATGGAAGTGGG + Intergenic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1044462682 8:92464297-92464319 CGAGGGAAAAGGTGGGAAGGTGG + Intergenic
1044560728 8:93609402-93609424 TGTGGGGAAAGGTGGGAACTGGG + Intergenic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045266375 8:100621990-100622012 TTGGGGTAGAGGTGAGAAGTGGG + Intronic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046982187 8:120348526-120348548 AGGGGGAAAGGGTGGGAAGTGGG + Intronic
1047237486 8:123054836-123054858 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
1047657771 8:126997372-126997394 GGGGGGAAACGGTGGGAAGTAGG - Intergenic
1048045082 8:130765425-130765447 ATGGGGGAAAGATGGGATGAGGG + Intergenic
1048845771 8:138602609-138602631 CTGCAGGCCAGGTGGGAAGTAGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049309587 8:141926598-141926620 CAGGGAGATAGGTGGGAAATGGG - Intergenic
1049448185 8:142641250-142641272 CTTGGGGAAAGGTGGGCAGGTGG + Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050368982 9:4901679-4901701 CTGGGGGAAGGGGGAGCAGTGGG - Intergenic
1050663461 9:7909017-7909039 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1051345704 9:16148982-16149004 TTGGGGAATAGGAGGGAAGTGGG - Intergenic
1051473167 9:17473077-17473099 CTTGGGTTCAGGTGGGAAGTAGG - Intronic
1051650053 9:19314125-19314147 TTGGGGGAAAGGGTGGAAGGAGG + Intronic
1051657547 9:19397329-19397351 GTTGGGGGAAGGTGGGAGGTGGG + Intergenic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1052061499 9:23966249-23966271 CTGGGGGAAGGGTAGGCTGTGGG - Intergenic
1052092086 9:24341080-24341102 ATGAGGGAAAGCTAGGAAGTAGG - Intergenic
1053198169 9:36136105-36136127 ATGGGGAAAAGGTGGGGCGTTGG + Intergenic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053535432 9:38920714-38920736 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1053672859 9:40386456-40386478 AAGGGGAAAAGGTGGGAAGGGGG + Intergenic
1053922672 9:43012837-43012859 AAGGGGAAAAGGTGGGAAGGGGG + Intergenic
1054207652 9:62145118-62145140 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1054383969 9:64526520-64526542 AAGGGGAAAAGGTGGGAAGGGGG + Intergenic
1054511767 9:65989827-65989849 AAGGGGAAAAGGTGGGAAGGGGG - Intergenic
1054630699 9:67443236-67443258 GTGGGAGAATGGTGGGAACTTGG - Intergenic
1054941005 9:70741817-70741839 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1055136046 9:72830226-72830248 CTGGGGTGAAGTTGGAAAGTTGG - Intronic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056897012 9:90560322-90560344 CAGGGGAAAGGGTGGGAAGTGGG + Intergenic
1056997725 9:91479240-91479262 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1057040954 9:91847073-91847095 CGGGGGGAAATGGGGGAAGATGG + Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057834700 9:98434883-98434905 CTAGGGGAATTGTGGGGAGTGGG + Intronic
1057846757 9:98531843-98531865 ATGGGTGAAGGGTGGGGAGTGGG - Intronic
1058087916 9:100770220-100770242 TTGGGGGAAAGGATGGAAGGGGG - Intergenic
1058093228 9:100829353-100829375 CTGGGGGAAAGGGTGGCTGTGGG - Intergenic
1058771253 9:108234526-108234548 TGGGAGGAAAGGTGGGAAGGGGG + Intergenic
1059009146 9:110437784-110437806 TTGAGGGAAGGGTGAGAAGTGGG - Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060680454 9:125558425-125558447 CTGGGGGTAAGCTGGGGAGTGGG - Intronic
1060738928 9:126084946-126084968 TCGGGGGAAAGCTGGGAACTTGG - Intergenic
1060851043 9:126876167-126876189 AAGGGGGAAAGGGGGGAAGGGGG - Intronic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1061000056 9:127897814-127897836 CTCGGGCAAAGGTGGGAAAGTGG - Intronic
1061911116 9:133725200-133725222 CTGGGGACAGGGTGGGAAATGGG + Intronic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062102872 9:134737658-134737680 CTGGGGAAGGGGTCGGAAGTGGG + Intronic
1062107519 9:134764014-134764036 CTGGGGGCATTGTGGGGAGTCGG + Intronic
1062501740 9:136854739-136854761 CTGCGGGAAAGGACGGGAGTGGG - Intronic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186032071 X:5378967-5378989 CAGGGGGATAGATGGGAAGCTGG - Intergenic
1186147293 X:6637629-6637651 CTAGGGGAAGGGTGGGATGAAGG - Intergenic
1186348810 X:8722349-8722371 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1186505696 X:10090153-10090175 TTGGAGGAAAGGTGGGAGGAAGG + Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186923949 X:14311606-14311628 CTGGGGGAGAGGTGGAAAATGGG + Intergenic
1187974362 X:24690607-24690629 CTCTGGGAAAGGTGAGAAGGAGG - Intergenic
1187987750 X:24833054-24833076 TGGGGGGAAAGGTGGGATGGGGG - Intronic
1189295619 X:39915425-39915447 CTGGGGGAGAGATGGGCAGGTGG + Intergenic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1190260018 X:48791721-48791743 CTGTGGAAAAGCTGGGAACTTGG + Intronic
1190505933 X:51125770-51125792 CTGGGGGAAAGGGTGGCTGTGGG + Intergenic
1191117570 X:56867465-56867487 ATGGGTGAAAGGTGAGATGTTGG - Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1191965619 X:66754013-66754035 CAAGGGGAAGGGTGGGAAGGGGG - Intergenic
1192068610 X:67913142-67913164 TTGAGGGGAAGGTTGGAAGTGGG - Intergenic
1192124441 X:68488766-68488788 ATGGGGGAGGGGTGGAAAGTAGG + Intergenic
1192233945 X:69284536-69284558 CTGGGGGCAGGATGGGAGGTGGG - Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1192951549 X:76022876-76022898 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1192978300 X:76310455-76310477 CGGGGGGAAGAGTGGGAGGTGGG - Intergenic
1193303475 X:79921181-79921203 CGTGGGGAAAGGTGTGAGGTGGG - Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193515463 X:82456448-82456470 GAGGGTGAAGGGTGGGAAGTGGG + Intergenic
1193595049 X:83435594-83435616 CTGGGGGAAAGGGCGGCTGTGGG - Intergenic
1193596976 X:83458787-83458809 TTGGGGGAAAGGTTGGGAGAGGG + Intergenic
1193874837 X:86849607-86849629 CAGGGGGAAGGCTGGGATGTGGG - Intergenic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1193917585 X:87383919-87383941 CAAGGGGAAGGGTGGGAAGGAGG + Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194602191 X:95935807-95935829 CAGGGGAAAGGGTGGGAGGTGGG - Intergenic
1194617470 X:96123281-96123303 CTTGGGGAAAAGTTGGGAGTGGG + Intergenic
1194638377 X:96373359-96373381 TTGGGGGAAAAGTAGGAATTAGG + Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194901261 X:99514459-99514481 CTGGGGGAAGGGGAGGCAGTGGG + Intergenic
1195173118 X:102288335-102288357 CGGAGGGAAAGGTGGAAAGAGGG - Intergenic
1195185748 X:102398760-102398782 CGGAGGGAAAGGTGGAAAGAGGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195401504 X:104465984-104466006 TTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1195479794 X:105331267-105331289 CTTGGGGAAAAATGTGAAGTGGG - Intronic
1195840297 X:109168562-109168584 CTGGAGGAGAGGTGTGAATTAGG - Intergenic
1195841589 X:109181239-109181261 CTGGGGAAAAGGTGGCAATGAGG - Intergenic
1195929169 X:110056170-110056192 GTGGGGGAAAGGTAGGGAGGGGG - Intronic
1196090253 X:111733284-111733306 CGGGGGAAATGGTGGGAAGGGGG - Intronic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196738090 X:118998453-118998475 TGGGGGGAAAAGTGGGAAGGGGG + Intronic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197150828 X:123218175-123218197 CTGGGAGAAAGTTGGGAGGTGGG + Intronic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197737746 X:129864417-129864439 CTGGGAGAAATGTTGGAATTGGG - Intergenic
1197882135 X:131178066-131178088 CTGGGACATAAGTGGGAAGTGGG + Intergenic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199559296 X:149146191-149146213 CTGGGGTGGGGGTGGGAAGTTGG + Intergenic
1199757682 X:150880538-150880560 CCAGGGGGAAGGTGGGAAATGGG + Intronic
1199928190 X:152491613-152491635 CAGGGAGAAAGGTGGGAAGCGGG - Intergenic
1200172254 X:154085751-154085773 GTGGGGGAAAGGGGAGAAGTGGG + Intronic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200226477 X:154420449-154420471 CTGGGGCAGAGGTGGGCTGTGGG + Intronic
1200365363 X:155657211-155657233 CTGGGGGAAGGGGTGGCAGTGGG - Intronic
1201229927 Y:11854308-11854330 TTGGGGGAAAGGAGGAAAGGTGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201462316 Y:14239843-14239865 CTGGGGGAAAGGGTGGCTGTGGG + Intergenic
1201714881 Y:17033590-17033612 TTGGGGGGAAGGGTGGAAGTGGG - Intergenic
1201850884 Y:18478609-18478631 CTGGGGGAAAGGGTGGCTGTAGG - Intergenic
1201882435 Y:18841769-18841791 CTGGGGGAAAGGGTGGCTGTAGG + Intergenic