ID: 1148534633

View in Genome Browser
Species Human (GRCh38)
Location 17:48429594-48429616
Sequence GATCCCCATGGGCCAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 497}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148534633_1148534644 13 Left 1148534633 17:48429594-48429616 CCTGGCCTTGGCCCATGGGGATC 0: 1
1: 1
2: 2
3: 26
4: 497
Right 1148534644 17:48429630-48429652 GCAGCCCCCTGGAGAGCCTCGGG 0: 1
1: 0
2: 2
3: 37
4: 372
1148534633_1148534650 27 Left 1148534633 17:48429594-48429616 CCTGGCCTTGGCCCATGGGGATC 0: 1
1: 1
2: 2
3: 26
4: 497
Right 1148534650 17:48429644-48429666 AGCCTCGGGGACCTCTAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 73
1148534633_1148534645 14 Left 1148534633 17:48429594-48429616 CCTGGCCTTGGCCCATGGGGATC 0: 1
1: 1
2: 2
3: 26
4: 497
Right 1148534645 17:48429631-48429653 CAGCCCCCTGGAGAGCCTCGGGG 0: 1
1: 0
2: 3
3: 17
4: 234
1148534633_1148534643 12 Left 1148534633 17:48429594-48429616 CCTGGCCTTGGCCCATGGGGATC 0: 1
1: 1
2: 2
3: 26
4: 497
Right 1148534643 17:48429629-48429651 CGCAGCCCCCTGGAGAGCCTCGG 0: 1
1: 0
2: 0
3: 27
4: 291
1148534633_1148534639 2 Left 1148534633 17:48429594-48429616 CCTGGCCTTGGCCCATGGGGATC 0: 1
1: 1
2: 2
3: 26
4: 497
Right 1148534639 17:48429619-48429641 ATGAGCCCCTCGCAGCCCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148534633 Original CRISPR GATCCCCATGGGCCAAGGCC AGG (reversed) Intronic
900161352 1:1225468-1225490 GATCCTCATGGAAGAAGGCCAGG + Intronic
900272479 1:1798643-1798665 GATCCCTAAGGGCCAATGCAGGG - Intronic
900486594 1:2925516-2925538 GACCCCCCAGGGCCAAGCCCCGG - Intergenic
900592195 1:3465110-3465132 GAGCCCCATGGGCCTGGGCCTGG - Intronic
900594028 1:3472356-3472378 GATCACCCTGGACCAAGGCCTGG + Intronic
900852417 1:5154406-5154428 GATCCCCATGTGTCAAGGGTGGG + Intergenic
900997796 1:6131791-6131813 GGGCCCCATGGGCCATGGGCGGG + Intronic
901808824 1:11754300-11754322 AATCCCCATGTGTCAAGACCGGG - Intronic
902096233 1:13948266-13948288 GATCCCCACGTGTCAAGGGCAGG + Intergenic
902368939 1:15993604-15993626 GTTCCCCCTGAGCCAGGGCCAGG - Intergenic
902421797 1:16286526-16286548 AATCCCCATGTGTCAAGGGCAGG - Intronic
902608001 1:17579995-17580017 CACACCCATGTGCCAAGGCCAGG + Intronic
902625110 1:17671843-17671865 TATCCCCATGGCCCAAGGCCAGG + Intronic
902653221 1:17850509-17850531 GAACAGCATGTGCCAAGGCCCGG + Intergenic
903281297 1:22251426-22251448 GAGTCCCCCGGGCCAAGGCCTGG + Intergenic
903645915 1:24896467-24896489 GAATCCCATGTGCAAAGGCCTGG - Intergenic
904334811 1:29789989-29790011 GCTCCCCATGGGCCCAGATCAGG + Intergenic
905298306 1:36968696-36968718 GCTCCACGTGGGGCAAGGCCAGG + Intronic
906006892 1:42481278-42481300 AATCACCATGGGACTAGGCCAGG + Intronic
906258562 1:44368825-44368847 GAACAGCATGAGCCAAGGCCAGG + Intergenic
906651515 1:47516218-47516240 AATCCCCATGTGTCAAGGGCAGG + Intergenic
906836076 1:49084594-49084616 AATCCCCATGTGTCAAGGGCAGG - Intronic
906939961 1:50247417-50247439 GATTCCTCAGGGCCAAGGCCAGG + Intergenic
907427435 1:54389439-54389461 GAACCCTATGAGCCCAGGCCAGG + Intronic
908593675 1:65661114-65661136 AATCCCCATGTGTCAAGGGCGGG - Intergenic
909113367 1:71506313-71506335 GCGCCCCAAGGGCCAAGCCCTGG - Intronic
909615896 1:77607341-77607363 AATCCCCATGTGTCAAGGGCAGG - Intronic
909782690 1:79566449-79566471 AATCCCCATGTGTCAAGGGCAGG - Intergenic
911501256 1:98687971-98687993 AATCCCCATGTGTCAAGGGCGGG - Intronic
914825860 1:151137764-151137786 GGTCTCCATGCTCCAAGGCCTGG + Exonic
915719714 1:157975870-157975892 CATCCCCATAGGCCCAGCCCTGG + Intergenic
916273536 1:162969308-162969330 AATCCCCATGTGTCAAGGACGGG + Intergenic
918230772 1:182529053-182529075 AATCCCCATGTGTCAAGGGCAGG - Intronic
918315237 1:183317565-183317587 GAAATCCATGGGTCAAGGCCAGG - Intronic
920370343 1:205474944-205474966 AATCCCCATGTGTCAAGGGCGGG + Intergenic
921238735 1:213154653-213154675 GTTCCCCACTGGCCAAGGGCAGG + Intronic
921930206 1:220748578-220748600 GAGCCACCTGGGCCAGGGCCGGG - Exonic
922682380 1:227611285-227611307 CATCCCCATGGGTCAAGGGTTGG - Intronic
923055099 1:230420484-230420506 AATCCCCATGTGTCAAGGGCGGG + Intronic
923082173 1:230668398-230668420 GGTCCCTGTGGGTCAAGGCCAGG + Intronic
923890707 1:238212400-238212422 GTTCCCAATGGGCCATGGACTGG - Intergenic
1063558918 10:7108211-7108233 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1063789523 10:9425843-9425865 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1063974900 10:11407238-11407260 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1064220590 10:13437288-13437310 GATCCCACTGGGGCAAGGCACGG + Intergenic
1064420155 10:15184062-15184084 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1065862839 10:29886115-29886137 GTCCCCCATGGCCCAAGGCTGGG - Intergenic
1066228303 10:33406696-33406718 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1067478793 10:46582482-46582504 GAGCCCCATAGGCCAGGGCCTGG - Intronic
1067615946 10:47759319-47759341 GAGCCCCATAGGCCAGGGCCTGG + Intergenic
1067805054 10:49386487-49386509 AAGCCACATGGGACAAGGCCTGG + Exonic
1068603361 10:58978709-58978731 GATCCTAATGGGCCACGGACAGG + Intergenic
1068671010 10:59723701-59723723 AATCCCCATGTGTCAAGGGCAGG - Intronic
1069323497 10:67203173-67203195 AATCCCCATGTGTCAAGGACAGG + Intronic
1071119827 10:82264447-82264469 AATCCCCATGTGTCAAGGGCAGG - Intronic
1071293492 10:84203311-84203333 GCTCCCCATGGGCAGAGACCAGG + Intronic
1072455114 10:95568604-95568626 GATCCCTATGGGGCATGGCCAGG - Intergenic
1072745990 10:97939520-97939542 GCACCCCATGGTGCAAGGCCAGG + Intronic
1074911834 10:117917927-117917949 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1076300015 10:129418890-129418912 GATCCCCCGGGGCCACAGCCAGG - Intergenic
1076532261 10:131152977-131152999 AATCCCCATGTGTCAAGGGCAGG - Intronic
1076688262 10:132207929-132207951 GAGGGCCATGGGCCGAGGCCTGG - Exonic
1078079184 11:8191802-8191824 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1079127462 11:17728541-17728563 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1079226992 11:18615200-18615222 GGTGACCATGGGCCCAGGCCTGG + Exonic
1079444381 11:20546071-20546093 GATCCCCGTGCGCCCAGGCAAGG + Intergenic
1079934118 11:26596829-26596851 GATCTCCACCGGCCAATGCCAGG + Intronic
1081050298 11:38331902-38331924 AATCCCCATGTGTCAAGGGCTGG + Intergenic
1081379722 11:42399788-42399810 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1081579645 11:44343476-44343498 GACCCCCATGTTCCATGGCCTGG + Intergenic
1082664038 11:55951064-55951086 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1082823701 11:57562345-57562367 GCTGTCCATGGGCCAGGGCCTGG - Intronic
1083310194 11:61779994-61780016 GCTGCCCATGGGCTCAGGCCTGG + Intronic
1083317934 11:61827930-61827952 GATCCTCCTGGGCCAATGGCAGG + Exonic
1083482042 11:62955422-62955444 AATCCCCATGTGGCAAGGGCAGG - Intronic
1083485508 11:62981052-62981074 GCTGACCATGGGCAAAGGCCAGG - Exonic
1083775868 11:64894119-64894141 GAAACCAAGGGGCCAAGGCCTGG + Intergenic
1084146313 11:67266959-67266981 GACCCGCAGGCGCCAAGGCCGGG - Intronic
1084617694 11:70247375-70247397 AATCCCCATGGGTCAAGGGAGGG - Intergenic
1084842773 11:71870161-71870183 AATCCCCATGTGTCAAGGGCAGG - Intronic
1085639156 11:78180821-78180843 AATCCCCATGTGTCAAGGGCAGG + Intronic
1085986451 11:81793596-81793618 AATCCCCATGTGTCAAGGCTGGG - Intergenic
1086374847 11:86189893-86189915 AATCCCCATGTGTCAAGGGCCGG - Intergenic
1087908423 11:103725680-103725702 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1088145181 11:106668476-106668498 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1088964784 11:114707702-114707724 GGTTGCCATGGGCCAAGGACAGG - Intergenic
1089614959 11:119690087-119690109 GAGCACCTTGTGCCAAGGCCTGG - Intronic
1090186433 11:124741984-124742006 TATCTCCATGGCCCAGGGCCTGG + Intronic
1091039297 11:132261931-132261953 GATGCCCATGGGGCAAGCCCTGG - Intronic
1091604437 12:1937975-1937997 GATCCCTAAGTGCCAATGCCAGG + Intergenic
1092050080 12:5462834-5462856 CATAGCCATGTGCCAAGGCCAGG + Intronic
1092665598 12:10792887-10792909 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1093014668 12:14144171-14144193 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1094488872 12:30946216-30946238 GATCCCCATTTGCCCAGGACAGG - Intronic
1095944302 12:47745423-47745445 GGGCCCCCTGGGCCAAGGACAGG - Intronic
1096113741 12:49043202-49043224 GAAACCCATGGGTCAAGGCCAGG + Intronic
1096630686 12:52925072-52925094 GACCTCAATGGGGCAAGGCCGGG + Intronic
1099025068 12:77455112-77455134 AATCCCCAGGGGCCAGGGACTGG - Intergenic
1101411275 12:104470481-104470503 AATCCCCATGTGTCAAGGGCAGG - Intronic
1102955219 12:117054567-117054589 GTGGCCCATGGGGCAAGGCCTGG - Intronic
1102976941 12:117213560-117213582 GACCCCAAAGGGCCCAGGCCAGG - Exonic
1103206442 12:119132825-119132847 GATTCACATGGGCCATGGCAAGG + Intronic
1104000193 12:124855300-124855322 AAGCCTCATGGCCCAAGGCCTGG - Intronic
1104480145 12:129100429-129100451 GATCACCATGAGGCATGGCCTGG - Intronic
1104608496 12:130207231-130207253 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1104752311 12:131247567-131247589 GAGCCCCAGGGGTCAAGGGCAGG + Intergenic
1104779623 12:131411661-131411683 GAGCCCCAGGGGACAAGGGCAGG - Intergenic
1104801597 12:131558533-131558555 TATCCGCATGGACCAAGCCCGGG + Intergenic
1104807920 12:131601253-131601275 AATCCCCATGTGTCAAGGGCGGG - Intergenic
1105277211 13:18943328-18943350 GTTCCCCATGGGACAGGGACAGG - Intergenic
1105460343 13:20579582-20579604 GCTACCCAAGAGCCAAGGCCTGG + Intronic
1105643279 13:22288337-22288359 AATCCCCATGTACCAAGGGCAGG - Intergenic
1106304894 13:28500791-28500813 CATCCCCATCAGCCAATGCCTGG - Intergenic
1106929955 13:34652999-34653021 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1107108231 13:36669741-36669763 AATCCCCATGTGTCAAGGCGAGG + Intergenic
1107285900 13:38791708-38791730 AATCCCCATGTGACAAGGGCAGG - Intronic
1107650002 13:42535506-42535528 AATCCCCATGTGTCAAGGTCAGG - Intergenic
1108853713 13:54767569-54767591 AATCCCCATGTGCCAAGGGTGGG + Intergenic
1110619296 13:77577508-77577530 GAGCCCCATGTGTCAAGGGCGGG - Intronic
1111263468 13:85775315-85775337 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1111291955 13:86182788-86182810 GTTGTCCAAGGGCCAAGGCCTGG - Intergenic
1111614463 13:90645086-90645108 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1113556408 13:111239170-111239192 AATCCCCATGTGTCAAGGGCGGG - Intronic
1114072649 14:19126912-19126934 GCTCCCCTTTGGCCAAGGGCAGG + Intergenic
1114089608 14:19273060-19273082 GCTCCCCTTTGGCCAAGGGCAGG - Intergenic
1114531439 14:23399026-23399048 GATGCCCATGGGCTGAGGGCAGG + Exonic
1115277424 14:31623496-31623518 AATCCCCATGTGTCAAGGGCAGG + Intronic
1115883249 14:37944415-37944437 AATCCCCATGTGTCAAGGGCAGG - Intronic
1117660331 14:57997623-57997645 AAACCCCATGTGCAAAGGCCAGG - Intergenic
1118377954 14:65193140-65193162 GAACCCCATGTGACAAGGGCGGG + Intergenic
1118533596 14:66733042-66733064 GATCCCCATGAGTCAAGGGAGGG + Intronic
1119564208 14:75614966-75614988 AATCCCCATGTGCCAAGGAAGGG - Intronic
1120400607 14:84025819-84025841 GATCCCCGTGTGTCAAGGGCGGG - Intergenic
1120732583 14:88020063-88020085 GAACACCATTGGCCAAGGCATGG - Intergenic
1120971782 14:90213979-90214001 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1121349397 14:93161503-93161525 GTACCCCATTGGCCAAGCCCAGG + Intergenic
1121498908 14:94417990-94418012 AATCCCCATGTGTCAAGGGCTGG + Intergenic
1122069413 14:99196003-99196025 GAAGCCCATGAGCCAAGTCCTGG + Intronic
1122399253 14:101457748-101457770 CATCCTCCTGGGCCCAGGCCAGG - Intergenic
1122777836 14:104130596-104130618 GATCCCCAGGGACCAGGGCTGGG - Intergenic
1122832571 14:104407494-104407516 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1123040139 14:105487087-105487109 GGTCCCCAGGGTCCAAGTCCTGG + Intergenic
1123859152 15:24445864-24445886 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1124568001 15:30833999-30834021 CATCCCCATGGCCCCTGGCCTGG + Intergenic
1124664477 15:31580790-31580812 AATCCCCATGTGTCAAGGGCAGG - Intronic
1124664746 15:31582710-31582732 AATTCCCATGGGTCAAGGGCAGG - Intronic
1125148943 15:36508944-36508966 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1125195299 15:37039053-37039075 GATCCCCAAGGCCCACTGCCTGG - Intronic
1128349506 15:66879754-66879776 GATCCCCATGGGCTAGGGTCAGG + Intergenic
1128360119 15:66956093-66956115 GAACAGCATGGGCAAAGGCCCGG - Intergenic
1128869527 15:71142963-71142985 GATGCCCTTGGGCTAATGCCTGG + Intronic
1129247832 15:74290640-74290662 GACCCCCATGTGCAAAGGCATGG + Intronic
1130688786 15:86062281-86062303 GATCTCCCTGGTCCAAGCCCAGG + Intergenic
1130954267 15:88615819-88615841 GATCCCCATGGTGCTGGGCCAGG - Intergenic
1131451551 15:92544410-92544432 AATCCCCATGTGTCAAGGGCTGG - Intergenic
1132159787 15:99529568-99529590 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134133804 16:11667242-11667264 GAGCCACATAGGCAAAGGCCTGG + Intergenic
1134354707 16:13470632-13470654 AATCCCCATGTGCCAAGGATGGG - Intergenic
1134368531 16:13602113-13602135 AATCCCCATGTGTCAAGGCTGGG - Intergenic
1135323620 16:21512551-21512573 GACCCCCGAGGGCCCAGGCCAGG - Intergenic
1136054128 16:27675356-27675378 AATCCCCATGTGTCAAGGGCAGG - Intronic
1136335106 16:29605816-29605838 GACCCCCGAGGGCCCAGGCCAGG - Intergenic
1136390820 16:29963137-29963159 GCTCCCCATGGGCAACTGCCAGG + Exonic
1137707101 16:50543263-50543285 GATCCCCATATGTCAAGGGCAGG + Intergenic
1137951773 16:52790832-52790854 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1138496705 16:57413333-57413355 GATGCCCATGTGCCCATGCCCGG + Intronic
1138546931 16:57725333-57725355 AATCCCCATAGGTCAAGGGCGGG - Intronic
1139436961 16:66941943-66941965 GACCCCCATGAGCAAAGGCCTGG + Intronic
1140583414 16:76257579-76257601 GATCCACATGGGACATTGCCAGG + Intergenic
1140628371 16:76822001-76822023 AATCCCCATGGGTCAAGGGCAGG - Intergenic
1141481640 16:84310340-84310362 GATCAGCACGGGCAAAGGCCTGG + Intronic
1142035827 16:87861650-87861672 GACCCCCGGGGGCCCAGGCCAGG - Intronic
1142746469 17:1961357-1961379 GAACCGCATGGGCGGAGGCCTGG + Intronic
1143203711 17:5129286-5129308 GATCCCAATGGGGCAGAGCCTGG + Intronic
1143259560 17:5587980-5588002 GAACCCCATGAGGCAATGCCTGG - Intronic
1143627775 17:8121157-8121179 GCTCTCCATGGCCCAAGCCCCGG - Exonic
1143870950 17:9956983-9957005 GAGACCTGTGGGCCAAGGCCAGG + Intronic
1144779454 17:17800514-17800536 GACACCCATGGGCCAGGGACAGG - Intronic
1144874892 17:18392397-18392419 GATCCCGATGGGGCAGAGCCTGG + Intergenic
1145157333 17:20552024-20552046 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1145799506 17:27673889-27673911 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1146159512 17:30552426-30552448 GATCCCGATGGGGCAGAGCCTGG + Intergenic
1146719348 17:35112838-35112860 GAGCACCATGGGGCAAGGACTGG + Intronic
1148214783 17:45828598-45828620 GATCCCCTTGGGCCAGGGATGGG + Intronic
1148534633 17:48429594-48429616 GATCCCCATGGGCCAAGGCCAGG - Intronic
1148955890 17:51353363-51353385 CACCCCCATGGGCCAAGGTGGGG - Intergenic
1148993424 17:51686034-51686056 AATCCCCATGGGTCAAGGGCAGG + Intronic
1149122917 17:53191289-53191311 AATACCCATGTGTCAAGGCCAGG - Intergenic
1149298042 17:55278570-55278592 GATTCCCATTGGTCAGGGCCTGG - Intronic
1149848010 17:60018553-60018575 GATCCCGATGGGGCAGAGCCTGG - Intergenic
1150086363 17:62275156-62275178 GATCCCGATGGGGCAGAGCCTGG - Intronic
1150226234 17:63526054-63526076 GATCTCAGGGGGCCAAGGCCAGG - Intronic
1150435779 17:65153093-65153115 GAACACCATGGGCAAAGGCATGG - Intronic
1150469536 17:65425079-65425101 AATCCCCATGTGCCAAGGGCAGG + Intergenic
1150614425 17:66758073-66758095 GATCTCCATGGGGCAAGGAAGGG + Intronic
1150718038 17:67588669-67588691 TATCCCCCTCGGCCAAGGTCGGG + Intronic
1151049043 17:70956042-70956064 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1151339861 17:73464217-73464239 AATCCCCATGTGTCAAGGGCAGG + Intronic
1152026585 17:77813476-77813498 AATCCCCATGTGTCAAGGCAGGG + Intergenic
1152576554 17:81143739-81143761 GATCCCCACGGGGTAAGGCGAGG + Intronic
1152815480 17:82405207-82405229 GAGGCCCAGGGGCCAGGGCCAGG - Intronic
1153101850 18:1480549-1480571 AATCCCCAGGTGTCAAGGCCAGG - Intergenic
1154490665 18:14919593-14919615 GTTCCCCATGGGACCAGGGCTGG - Intergenic
1155094637 18:22543980-22544002 CATCCCCTGGGGTCAAGGCCTGG + Intergenic
1155716805 18:28953711-28953733 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1156641644 18:39108004-39108026 AATCTCCATGTGCCAAGGGCAGG + Intergenic
1157673637 18:49551583-49551605 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1157862506 18:51153837-51153859 GGTCCCCATGCCCCCAGGCCAGG + Intergenic
1157936716 18:51881739-51881761 CATCCCCATGGGCCAAGGCCAGG - Intergenic
1158680764 18:59564828-59564850 TACCACCATGGACCAAGGCCAGG - Intronic
1159261201 18:66015632-66015654 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1159448000 18:68564123-68564145 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1159455621 18:68657320-68657342 AATCCCCATGTGTCAAGGCGAGG - Intergenic
1160106977 18:75987395-75987417 GAGCCCCATGGGTCCAGGCCCGG + Intergenic
1160243599 18:77140055-77140077 AATCCCCATGTGTCAAGGCCAGG + Intergenic
1161043480 19:2122222-2122244 GATACCCTTGGCCCAAGGCAGGG + Intronic
1161156196 19:2732957-2732979 GATCCCCCTGGGCATCGGCCTGG - Exonic
1161379657 19:3958392-3958414 TATCCCCAGTGGCCAAGGGCTGG + Intergenic
1161501339 19:4617734-4617756 GACCAGCATGGGCAAAGGCCGGG - Intergenic
1161706044 19:5822294-5822316 GAACCCCATGAGCCGAGCCCAGG + Intergenic
1162042520 19:7979315-7979337 GGACCCCAGGGGCCCAGGCCTGG - Intronic
1163313473 19:16527603-16527625 CATACCCCTGGGCCAAGGCAGGG - Intronic
1164417644 19:28059867-28059889 GTTCTCCTTGGGCCCAGGCCAGG - Intergenic
1164650773 19:29889963-29889985 AATCCTCACAGGCCAAGGCCAGG - Intergenic
1166389855 19:42402768-42402790 GAGCCCCATGGACAGAGGCCTGG - Exonic
1166862255 19:45817214-45817236 GCTCCCCCTGGGCCAGGCCCAGG + Intronic
1168537048 19:57179791-57179813 AATCCCCATGTGGCAAGGGCAGG + Intergenic
925468197 2:4130196-4130218 GATCTCCATGGACTAGGGCCAGG + Intergenic
925698986 2:6613853-6613875 GTTAGCCAGGGGCCAAGGCCTGG + Intergenic
926398346 2:12468680-12468702 AATCCCCATGTGTCAAGGGCAGG + Intergenic
927095228 2:19743104-19743126 GCTCCACATTGGCCAAGGCAAGG - Intergenic
927484402 2:23478877-23478899 GAACACCATGGGCCATGTCCTGG + Intronic
927927550 2:27024362-27024384 GTGCCCCCTGGGCCACGGCCCGG + Intronic
930593413 2:53356663-53356685 CCTCCCCATGGGGCAAGGCTTGG + Intergenic
932099058 2:68879958-68879980 GATTCCCATGGGTCGAGCCCTGG - Intergenic
936635338 2:114249919-114249941 AATCCCCATGTGTCAAGGGCAGG + Intergenic
936805263 2:116324114-116324136 AATCCCCATGTGTCAAGGGCAGG + Intergenic
937223874 2:120357112-120357134 GGTCCCCAGGGGCCAGGGTCAGG + Intergenic
937889338 2:126925258-126925280 AATCCCCATGTGTCAAGGGCAGG + Intergenic
937889599 2:126927163-126927185 AATCCCCATGTGTCAAGGGCAGG + Intergenic
938298925 2:130196774-130196796 GGTCACCATGGTCCAAGCCCAGG + Intronic
938384414 2:130854226-130854248 GATCCCCAAGCACCAAGGACAGG - Intronic
938457797 2:131477739-131477761 GGTCACCATGGTCCAAGCCCAGG - Intronic
939666959 2:144964396-144964418 AATCCCCATGTGTCAAGGGCAGG + Intergenic
940446429 2:153783639-153783661 AATCCCCATGTGTCAAGGGCGGG + Intergenic
941461131 2:165773171-165773193 AATCCCCATGTGTCAAGGGCAGG + Intronic
941917799 2:170823556-170823578 GACGCCCGTGGGGCAAGGCCAGG + Intronic
941967105 2:171311465-171311487 AATCCCCATGTGTCAAGGGCTGG + Intergenic
942035143 2:172003439-172003461 AATCCCCATGTGTCAAGGGCAGG + Intronic
942742252 2:179194326-179194348 GATCCCCATTTGCCACGTCCTGG - Intronic
943115489 2:183664523-183664545 AATCCCCATGTGTCAAGGTCAGG - Intergenic
943232057 2:185266016-185266038 AATCCCCATGTGTCAAGGGCAGG - Intergenic
943701830 2:190995577-190995599 AATCCCCATGTGTCAAGGGCAGG - Intronic
944132081 2:196357634-196357656 AATCCCCATGTGCCAAGGGAAGG + Intronic
944937028 2:204580079-204580101 GGTCCCCCTGGGTCAAGGACTGG - Intronic
945144421 2:206722171-206722193 AATCCCCATGTGTCAAGGGCAGG + Intergenic
946142143 2:217700484-217700506 AATCCCCATGTGTCAAGGGCAGG + Intronic
946769823 2:223077256-223077278 AATCCCCATGTGTCAAGGGCAGG - Intronic
946863555 2:224022804-224022826 AATCCCCCTGTGCCAAGGGCAGG + Intronic
947324609 2:228960898-228960920 AATCCCCATGTGTCAAGGGCAGG - Intronic
948130834 2:235599598-235599620 GAGCCACATGGGCCATGGCAGGG - Intronic
948200912 2:236129209-236129231 GCTCCCCATGCCCCCAGGCCAGG + Exonic
948601351 2:239109097-239109119 TGTCACCAGGGGCCAAGGCCTGG - Intronic
948774450 2:240275961-240275983 AATCCCCATGTGCCAAGGGAGGG + Intergenic
1169143191 20:3237613-3237635 CAGCCCCATGGACCAAGCCCTGG + Intronic
1169592964 20:7164895-7164917 CATCCCCATGTGTCAAGGGCAGG + Intergenic
1169709985 20:8550334-8550356 AATCCCCATGTGTCAAGGACAGG + Intronic
1170750498 20:19140674-19140696 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1171321412 20:24247726-24247748 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1172786001 20:37469383-37469405 GCTTCCCATCGGCCAAGCCCAGG + Intergenic
1173027662 20:39324620-39324642 GATCCGTATGGGGAAAGGCCAGG - Intergenic
1173183414 20:40821240-40821262 GCTGCCCATGGGCCAGAGCCTGG + Intergenic
1173299554 20:41789603-41789625 GTTCCCCACTGGCCAAGCCCAGG + Intergenic
1173655877 20:44700024-44700046 GCTCACCATGTGCCAAGCCCTGG + Intergenic
1173785722 20:45791720-45791742 TTTCCCGCTGGGCCAAGGCCTGG - Intronic
1174510237 20:51045836-51045858 AATCCCCATGTGTCAAGGGCGGG - Intergenic
1174540765 20:51287516-51287538 AATCCCCATGTGCCAAGGGCAGG - Intergenic
1175230925 20:57472666-57472688 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1175485852 20:59345605-59345627 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1176671061 21:9735767-9735789 CCTCCCCATGGGGCAAGGCTCGG + Intergenic
1176876526 21:14135611-14135633 GATTCCCCTGTGGCAAGGCCTGG - Intronic
1177855197 21:26392862-26392884 AATCCCCATGTGCCAAGGGCGGG - Intergenic
1177918604 21:27123313-27123335 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1177931893 21:27295643-27295665 TATCCCCATGTGTCAAGGTCGGG - Intergenic
1178013830 21:28318695-28318717 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1178100686 21:29265788-29265810 AATCCCCATGTGTCAAGGCCAGG + Intronic
1178111002 21:29370228-29370250 AATCCCCATGTGTCAAGGTCAGG - Intronic
1178365287 21:31985114-31985136 AATCCCCATGTGTCAAGGGCGGG - Intronic
1178367321 21:31998645-31998667 GAGCCCCATCAGCCAGGGCCCGG + Exonic
1179658341 21:42859570-42859592 GATCCACAGGGGCCAGGTCCAGG + Intronic
1180099255 21:45576787-45576809 GTTCCCCCTGGGGCAGGGCCAGG + Intergenic
1180491095 22:15849287-15849309 GCTCCCCTTTGGCCAAGGGCAGG + Intergenic
1180685816 22:17665574-17665596 AATCCCCATGTGTCAAGGGCGGG - Intronic
1182134810 22:27891566-27891588 GATCCCCATGTGTCAAGGAAGGG + Intronic
1182440714 22:30362371-30362393 GCTCCCCAGGGCCCCAGGCCGGG - Intronic
1183735113 22:39640736-39640758 GAACAGCATGTGCCAAGGCCTGG + Intronic
1184033030 22:41905838-41905860 GATGCCCATGGTCCAGGGCCTGG + Exonic
1184048488 22:41987409-41987431 GCTCCCCAGGGGCCCTGGCCTGG - Intronic
1184678744 22:46058117-46058139 GATCCCCAGGGGAAACGGCCTGG + Intronic
1184799789 22:46752483-46752505 GGTCCACATGGGCTAGGGCCAGG + Intergenic
1185000361 22:48241787-48241809 GATCCTCATGGAGCAAGGCGTGG + Intergenic
950542044 3:13618575-13618597 GATCACCATGGGCCCAGCACTGG - Intronic
950853256 3:16082723-16082745 AATCCCCATGTGTCAAGGGCAGG - Intergenic
951746157 3:25980053-25980075 AATCCCCATGTGCCAAGGGCAGG + Intergenic
952504689 3:33996984-33997006 AATCCCCATGTGTCAAGGGCAGG - Intergenic
952579518 3:34815856-34815878 AATCCCCATGTGTCAAGGACAGG + Intergenic
953049607 3:39328758-39328780 AATCCCCATGTGTCAAGGGCGGG - Intergenic
953979057 3:47404735-47404757 GGTCCCCATGGGCTCGGGCCAGG + Exonic
954755305 3:52835982-52836004 GATCCCCCAGGGCACAGGCCAGG + Intronic
955043200 3:55336354-55336376 AGCCCCCATGGGCCAAGGGCTGG + Intergenic
955067860 3:55547955-55547977 GACCCCCATGAGACAGGGCCAGG + Intronic
955886122 3:63600565-63600587 AATCCCCATGTGTCAAGGACAGG + Intronic
956607708 3:71089623-71089645 GATCCCCATGTGGCAAGGATGGG - Intronic
956860493 3:73319053-73319075 AATCCCCATGTGTCAAGGGCAGG + Intergenic
956909568 3:73803630-73803652 GATCCCCACGTGCCAAGGGAGGG + Intergenic
957212445 3:77276984-77277006 AATCCCCATGAGTCAAGGGCAGG - Intronic
957257985 3:77863341-77863363 GATCCCCATGTGCCAAGGGAGGG + Intergenic
957360549 3:79150964-79150986 AATCCCCATGTGTCAAGGGCAGG + Intronic
957418415 3:79935731-79935753 AATCCCCATGTGTCAAGGGCAGG - Intergenic
957566980 3:81896610-81896632 AATCCCCATGTGTCAAGGGCAGG - Intergenic
957676907 3:83378537-83378559 AATCCCCATGTGTCAAGGGCAGG - Intergenic
958189113 3:90161915-90161937 AATCCCCATGTGTCAAGGGCGGG + Intergenic
958196135 3:90244637-90244659 AATCCCCATGTGTCAAGGGCAGG + Intergenic
958419324 3:93913282-93913304 AATCCCCATGTGTCAAGGGCAGG + Intronic
958432815 3:94062397-94062419 TATCCCCATGGGCCAGGTCTGGG + Intronic
958640377 3:96797714-96797736 GATCCCCATGTGTCAAGGGTGGG - Intergenic
959432828 3:106275901-106275923 AATCCCCATGTGTCAAGGGCAGG - Intergenic
959477002 3:106823135-106823157 AATCCCCATGTGTCAAGGGCGGG - Intergenic
959740958 3:109719160-109719182 AATCCCCATGTGTCAAGGGCAGG - Intergenic
959771920 3:110108805-110108827 AATCCCCATGTGTCAAGGGCGGG - Intergenic
961641976 3:128370550-128370572 TATCCCCATGGGGCTAAGCCAGG + Intronic
962255942 3:133870340-133870362 GATCCCCACGTGTCAAGGACAGG - Intronic
963248523 3:143084260-143084282 GAACCCCATGGGGCAGGGCGAGG - Intergenic
963803265 3:149698202-149698224 AATCCCCATGTGTCAAGGGCAGG + Intronic
965065295 3:163840495-163840517 AATCCCCATGTGTCAAGGGCAGG - Intergenic
965410077 3:168319394-168319416 AATCCCCATGTGTCAAGGGCAGG - Intergenic
967459493 3:189728863-189728885 AATCCCCATGTGTCAAGGGCAGG - Intronic
967554176 3:190835488-190835510 AATCCCCATGTGTCAAGGGCAGG + Intergenic
968707405 4:2086518-2086540 GAGCCCCATGAGCTAAGGCATGG + Intronic
969321860 4:6417380-6417402 GATTCCCAAGGCCCAAGGCCTGG - Intronic
969489533 4:7491199-7491221 GAACAGCATGTGCCAAGGCCTGG - Intronic
969624454 4:8295239-8295261 GATCTCCATGGGCCACAGGCTGG - Intronic
969783874 4:9436217-9436239 AATCCCCATGTGTCAAGGGCAGG - Intergenic
970678140 4:18476569-18476591 AATCCCCATGAGTCAAGGGCAGG - Intergenic
971677575 4:29653438-29653460 AATCCCCATGTGTCAAGGGCAGG - Intergenic
971701615 4:29984648-29984670 GCTGCCCATGAGCCTAGGCCTGG - Intergenic
972579213 4:40380035-40380057 GCTACCCAGGAGCCAAGGCCTGG - Intergenic
972752989 4:42011347-42011369 AATCCCCATGTGTCAAGGGCAGG - Intronic
972753887 4:42023994-42024016 AATCCCCATGTGCCGAGGACAGG - Intronic
972865657 4:43228838-43228860 AATCCCCATGTGTCAAGGGCGGG - Intergenic
972910539 4:43810824-43810846 AATCCCCATGTGTCAAGGGCAGG - Intergenic
972997858 4:44904896-44904918 AATCCCCATGTGTCAAGGGCAGG + Intergenic
974317824 4:60305700-60305722 AATCCCCATGTGTCAAGGACGGG - Intergenic
974360021 4:60865494-60865516 GATCCACATTGGCTAAGGCTAGG - Intergenic
974557201 4:63466052-63466074 AATCCCCATGTGTCAAGGGCAGG - Intergenic
976427871 4:84927573-84927595 AATCCCCATGTGTCAAGGGCGGG + Intronic
976735517 4:88304869-88304891 AATCCCCATGTGTCAAGGGCGGG - Intergenic
977641042 4:99358887-99358909 GATCCCCATGTGTCAAGGGTGGG + Intergenic
979211396 4:118108176-118108198 AATCCCCATGTGTCAAGGCTGGG - Intronic
979645433 4:123061604-123061626 AATCCCCATGTGTCAAGGGCAGG - Intronic
979840740 4:125436819-125436841 AATCCCCATGTGTCAAGGGCAGG - Intronic
980172095 4:129302143-129302165 GATCCCCAAGTGTCAAGGGCAGG - Intergenic
981343447 4:143648468-143648490 AATCCCCATGTGTCAAGGGCAGG + Intronic
983146855 4:164227365-164227387 GATCCCCATGTGTCAAGGGTGGG - Intronic
983348755 4:166560065-166560087 AATCCCCATGTGTCAAGGGCGGG + Intergenic
983855124 4:172633756-172633778 TATCCCCATGTGTCAAGGACAGG + Intronic
984279896 4:177658020-177658042 AATCCCCATGTGTCAAGGGCAGG + Intergenic
986204129 5:5607487-5607509 AATCCCCATGTGTCAAGGGCAGG - Intergenic
986761844 5:10887099-10887121 AATCCCCATGTGTCAAGGGCAGG - Intergenic
986797963 5:11230999-11231021 AATCCCCATGTGTCAAGGGCAGG + Intronic
987610523 5:20197880-20197902 AATCCCCATGTGTCAAGGGCGGG + Intronic
988386032 5:30566305-30566327 AATCCCCATGTGTCAAGGGCAGG - Intergenic
988653327 5:33178319-33178341 AATCCCCATGTGTCAAGGGCAGG + Intergenic
989132631 5:38123210-38123232 AATCCCCATGTGTCAAGGGCAGG - Intergenic
989475412 5:41869000-41869022 GATACCCTTGGGCCGAGGTCAGG - Intronic
990336403 5:54776843-54776865 AATCCCCATGTGTCAAGGGCAGG - Intergenic
993481745 5:88432178-88432200 AATCCCCATGTGCCAAGGGAGGG - Intergenic
993703743 5:91147418-91147440 AATCCCCATGTGTCAAGGGCAGG + Intronic
993704011 5:91149282-91149304 AATCCCCATGTGTCAAGGGCAGG + Intronic
993777112 5:92013010-92013032 AATCCCCATGGGTCAAGGGTGGG + Intergenic
994749419 5:103720417-103720439 GATCACCATGTGCCAAGGGTGGG - Intergenic
995925429 5:117368321-117368343 TATCCCCATGTGTCAAGGGCAGG + Intergenic
996955654 5:129180404-129180426 AATCCCCATGTGTCAAGGCTGGG + Intergenic
997086598 5:130806941-130806963 GATTCCCATGTGTCAAGGGCAGG + Intergenic
997282646 5:132658473-132658495 AATCTCCATGGACCAAGGCCCGG + Intronic
998094557 5:139389945-139389967 GTTCCCCATTGGTCTAGGCCAGG - Intronic
998618215 5:143764607-143764629 AATCCCCATGTGTCAAGGGCAGG - Intergenic
998708237 5:144789879-144789901 GAGCCCTATGGGCCAAAGACAGG + Intergenic
998758534 5:145406955-145406977 GAACCCCATGAGATAAGGCCAGG - Intergenic
998926215 5:147129002-147129024 AATCCCCATGTGTCAAGGGCAGG - Intergenic
999325921 5:150643460-150643482 GATCCCCTTGGGACAGGGTCAGG - Intronic
1001836563 5:174837453-174837475 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1002648559 5:180674365-180674387 GGTCTCCATAGGCCAAGGCTGGG - Intergenic
1004163339 6:13233686-13233708 AATCCCCATGTGTCAAGGGCAGG - Intronic
1006186299 6:32183474-32183496 GGCCCTCATGGGCCAAGGCTGGG + Intronic
1006913793 6:37581708-37581730 GCTTCCCATGGGCCCAGCCCTGG - Intergenic
1007902391 6:45423359-45423381 GAGCCCCAGGGGACAATGCCGGG - Intronic
1011055539 6:83199776-83199798 AATCCCCATGTGTCAAGGACAGG - Intergenic
1011845141 6:91553454-91553476 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1012297753 6:97546147-97546169 ATTCCCCTTTGGCCAAGGCCGGG + Intergenic
1013726156 6:113098088-113098110 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1013949141 6:115758406-115758428 AATCCCCATGTGCCAAGGGAGGG + Intergenic
1014766192 6:125409473-125409495 AATTCCCATGTGCCAAGGGCAGG + Intergenic
1015673905 6:135723441-135723463 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1015844329 6:137503773-137503795 AATCCCCATGTGTCAAGGGCGGG - Intergenic
1016456914 6:144240386-144240408 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1017762231 6:157578607-157578629 AATCCCCATGTGTCAAGGGCAGG + Intronic
1017774925 6:157673121-157673143 GACCCACATGGCCCCAGGCCGGG + Exonic
1018104346 6:160468592-160468614 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1018112536 6:160549190-160549212 AATCCCCATGTGTCAAGGGCAGG - Intronic
1019144234 6:169966579-169966601 GCTCCCCATGGGCCAGTGCTGGG + Intergenic
1019814790 7:3191606-3191628 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1019862995 7:3677589-3677611 AATCCCCATGTGTCAAGGGCAGG - Intronic
1020125362 7:5530230-5530252 GATCCCCATTGGCAAGAGCCCGG + Intronic
1021687820 7:23204666-23204688 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1022124213 7:27340158-27340180 GGTCCCAATGGCCCAAGGACTGG + Intergenic
1022442583 7:30446346-30446368 GATCCACAAGAGCCATGGCCTGG + Intronic
1022492365 7:30830835-30830857 GAGCCACATGGGCAAATGCCTGG + Intronic
1022978134 7:35577107-35577129 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1024038853 7:45533650-45533672 GACCACAATGGACCAAGGCCTGG + Intergenic
1024182334 7:46908697-46908719 GGTCCCCTTGGGCCAAGATCTGG - Intergenic
1024685877 7:51744652-51744674 GACCACCAGGGACCAAGGCCGGG + Intergenic
1026236017 7:68528079-68528101 GATCTCCATGGGCCAAGTAGGGG - Intergenic
1026642369 7:72139158-72139180 GATGCCCATGGGCTCTGGCCTGG - Intronic
1027462895 7:78477702-78477724 AATCCCCATGTGTCAAGGGCGGG - Intronic
1027916028 7:84322434-84322456 AATCCCCATGTGTCAAGGGCAGG + Intronic
1028097334 7:86777601-86777623 GATGCCCATGTCCCAAGACCAGG - Intronic
1028286645 7:89011263-89011285 GATTCCCATGTGTCAAGGGCAGG - Intronic
1028305264 7:89255297-89255319 AATCCCCATGTGTCAAGGGCAGG - Intronic
1028661961 7:93288168-93288190 AATCCCCATGTGTCAAGGGCGGG - Intronic
1029420837 7:100471124-100471146 GATCCCCCAGGGCCTAGGTCTGG + Intronic
1029535638 7:101155670-101155692 GATACCCCTGGGCATAGGCCTGG + Intronic
1029737265 7:102471844-102471866 CAGCCCCCTGGGCCATGGCCTGG + Intronic
1030416987 7:109257938-109257960 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1031614858 7:123868500-123868522 GAAGCCCACTGGCCAAGGCCAGG + Exonic
1031768192 7:125807484-125807506 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1032976716 7:137232743-137232765 AATCCCCATGTGTCAAGGGCAGG + Intronic
1033491903 7:141852640-141852662 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1033737024 7:144232363-144232385 GAACCACATGGGCCAGAGCCAGG + Exonic
1033746033 7:144318583-144318605 GAACCACATGGGCCAGAGCCAGG - Exonic
1034518734 7:151602728-151602750 AATCCCCACGTGCCAAGGGCAGG + Intronic
1034764098 7:153701358-153701380 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1035129171 7:156636318-156636340 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1035445199 7:158936548-158936570 GCTCCCCATGGGCTGAGGCAGGG - Intronic
1036835170 8:12057900-12057922 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1036857013 8:12304464-12304486 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1037037173 8:14181560-14181582 AATCCCCATGTGACAAGGGCGGG + Intronic
1037468527 8:19184581-19184603 TATGGCCAGGGGCCAAGGCCAGG + Intergenic
1037803080 8:22045466-22045488 GAGCACCAGGGGGCAAGGCCGGG + Intronic
1037819883 8:22130492-22130514 GCTCCCCATGGGCCAGCTCCGGG + Exonic
1038741171 8:30218411-30218433 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1038951568 8:32420820-32420842 AATCCCCATGTGTCAAGGGCGGG + Intronic
1039071491 8:33652887-33652909 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1041496274 8:58488468-58488490 GATTCCCATGGGCCAGGGCCAGG - Intergenic
1042470219 8:69179027-69179049 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1043005627 8:74814754-74814776 GTTCCCAATGGGCCATGGACTGG + Intronic
1043765627 8:84128268-84128290 AATCCCCACGTGCCAAGGGCAGG - Intergenic
1044300513 8:90577825-90577847 GATCCCCACGTGTCAAGGGCAGG - Intergenic
1045297430 8:100884320-100884342 AATCCCCATGTGTCAAGGACAGG + Intergenic
1045394140 8:101743895-101743917 GATCCCTTCGGGCCAAGGCTCGG + Intronic
1045416308 8:101971373-101971395 AATCCCCATGTGTCAAGGGCAGG + Intronic
1046940421 8:119925530-119925552 AATCCCCATGTGTCAAGGGCAGG - Intronic
1047325826 8:123834953-123834975 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1048222083 8:132551421-132551443 AATCCCCATGTGTCAAGGGCGGG - Intergenic
1048416948 8:134236678-134236700 AATCCCCATGTGTCAAGGTCAGG - Intergenic
1048424034 8:134306131-134306153 AAGCCCTCTGGGCCAAGGCCTGG - Intergenic
1048729069 8:137418049-137418071 AATTCCCATGTGCCAAGGGCAGG - Intergenic
1049382716 8:142325456-142325478 GGAGCCCAGGGGCCAAGGCCGGG + Intronic
1050412615 9:5382469-5382491 GAACAGCATGGGCCAAAGCCTGG + Intronic
1050901757 9:10959355-10959377 AATCCCCATGTGTCAAGGGCGGG + Intergenic
1051676378 9:19562672-19562694 GGAACCCATGTGCCAAGGCCTGG + Intronic
1051885954 9:21893195-21893217 GATCCCCATGTGTCAAGGGCAGG - Intronic
1052600026 9:30615624-30615646 AATCCCCACGTGCCAAGGGCAGG + Intergenic
1055019778 9:71657345-71657367 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1055120471 9:72655024-72655046 GATCCCCATGTGTCAAGGGTGGG + Intronic
1056012059 9:82342754-82342776 AATCCCCATGCGTCAAGGGCGGG + Intergenic
1058831611 9:108823030-108823052 AATCCCCATGTGTCAAGGGCTGG - Intergenic
1059570909 9:115434611-115434633 GATCCCCATATGCCAAGGGTGGG + Intergenic
1059587529 9:115621908-115621930 AATCCCCATGTGTCAAGGGCTGG - Intergenic
1061178815 9:129012330-129012352 GGTCACCCTGGGCCAGGGCCAGG + Intronic
1061222480 9:129260216-129260238 GAGCCACACAGGCCAAGGCCAGG - Intergenic
1061282364 9:129604673-129604695 GATTCCACTGCGCCAAGGCCAGG + Intergenic
1061576151 9:131507838-131507860 CATCTCAATTGGCCAAGGCCTGG - Intronic
1061847198 9:133394445-133394467 GTTCCCCACGCGCCCAGGCCTGG + Intronic
1062117303 9:134816444-134816466 GACCCCCATGGGCCCTGGGCAGG + Intronic
1062149704 9:135011347-135011369 GACCCCCATGAGGCCAGGCCTGG + Intergenic
1062178903 9:135180136-135180158 GAGCCAGATGGCCCAAGGCCGGG - Intergenic
1062274005 9:135722135-135722157 GATACCCCTGGGCCCAGGGCTGG + Intronic
1062279210 9:135744524-135744546 GAGCCCCAAGGACCCAGGCCTGG + Intronic
1185528907 X:801603-801625 GATCCCCATGGGTCAAGGGGGGG + Intergenic
1185767917 X:2741018-2741040 GACCCCCATTCTCCAAGGCCCGG + Exonic
1186038906 X:5455023-5455045 GCTCCCCATGTGTCAAGGGCAGG + Intergenic
1187810873 X:23175179-23175201 AATCCCCATGTGTCAAGGGCTGG - Intergenic
1188094151 X:26002060-26002082 GAGCTCCCTTGGCCAAGGCCAGG + Intergenic
1188297227 X:28463948-28463970 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1188361516 X:29260562-29260584 AATCCCCATGTGTCAAGGGCGGG - Intronic
1188754018 X:33937760-33937782 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1189887159 X:45559424-45559446 TATCCCCATGTGTCAAGGGCAGG + Intergenic
1190324597 X:49199182-49199204 GAGCCCCAGGGTCCAAGGACTGG + Intronic
1191052433 X:56208113-56208135 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1191140811 X:57114787-57114809 AATCCCCATGTGTCAAGGGCGGG - Intergenic
1191602957 X:63030604-63030626 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1192960202 X:76122211-76122233 AATCCCCATGTGTCAAGGTCGGG + Intergenic
1193483448 X:82057212-82057234 AATCCCCATATGCCAAGGGCGGG + Intergenic
1193787752 X:85781273-85781295 AATCCCCATGTGCCAAGGGCTGG + Intergenic
1194093003 X:89601298-89601320 AATCCCCATGTGTCAAGGTCAGG - Intergenic
1194627953 X:96247893-96247915 GATCTTGATGGACCAAGGCCAGG + Intergenic
1194921945 X:99778231-99778253 GTTCCCCATTGGCCCAGGGCAGG + Intergenic
1195326006 X:103759090-103759112 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1196173766 X:112617759-112617781 AATCCCCATGTGCCAAAGGCAGG + Intergenic
1196209138 X:112975144-112975166 TATCCCCATGGGCCAATGAGTGG + Intergenic
1196248448 X:113428828-113428850 GCTGTCCATGAGCCAAGGCCTGG - Intergenic
1197223383 X:123933859-123933881 AATCCTCATGTGTCAAGGCCGGG + Intergenic
1197441152 X:126493277-126493299 AATCCCCATGTGTCAAGGGCAGG + Intergenic
1197665305 X:129216773-129216795 AATCCCCATGTGTCAAGGGCAGG - Intergenic
1197970318 X:132108709-132108731 AATCCCCATGTGTCAAGGGCGGG + Intronic
1198578077 X:138032753-138032775 GATCCCCATGTGTCATGGCAGGG + Intergenic
1198775128 X:140171674-140171696 AATCCCCATGTGTCAAGGACAGG + Intergenic
1199193148 X:144996222-144996244 AATCCCCATGTGCCAAGGGCAGG + Intergenic
1199510687 X:148618513-148618535 AATCCCCATGTGTCAAGGTCAGG - Intronic
1200445641 Y:3257401-3257423 AATCCCCATGTGTCAAGGTCAGG - Intergenic
1200750392 Y:6939532-6939554 GATCCCCATGTCCCAAACCCTGG - Intronic
1200942079 Y:8794690-8794712 GTTCCCCATGGGCCAGACCCAGG - Intergenic
1201065461 Y:10091137-10091159 CCTCCCCATTGGCCAAGGTCAGG - Intergenic
1201434563 Y:13943045-13943067 GATCCTCATGGGCTGAGGCACGG - Intergenic
1202110134 Y:21409215-21409237 GTTCCCCAGAGGCCAAGGCAAGG - Intergenic