ID: 1148534746

View in Genome Browser
Species Human (GRCh38)
Location 17:48430045-48430067
Sequence CACTGGAGGGGGCCTGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148534737_1148534746 -1 Left 1148534737 17:48430023-48430045 CCCCTTTCGGCCTTCGGCTCAGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214
1148534735_1148534746 7 Left 1148534735 17:48430015-48430037 CCTGGTGTCCCCTTTCGGCCTTC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214
1148534733_1148534746 17 Left 1148534733 17:48430005-48430027 CCGTGGGAGGCCTGGTGTCCCCT 0: 1
1: 0
2: 1
3: 30
4: 315
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214
1148534738_1148534746 -2 Left 1148534738 17:48430024-48430046 CCCTTTCGGCCTTCGGCTCAGCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214
1148534739_1148534746 -3 Left 1148534739 17:48430025-48430047 CCTTTCGGCCTTCGGCTCAGCAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214
1148534732_1148534746 22 Left 1148534732 17:48430000-48430022 CCTGGCCGTGGGAGGCCTGGTGT 0: 1
1: 0
2: 1
3: 21
4: 216
Right 1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148534746 Original CRISPR CACTGGAGGGGGCCTGCGCC AGG Intronic
900143918 1:1149925-1149947 CAATGGAGGGGGGCTGCCCAAGG + Intergenic
900396215 1:2454223-2454245 CACTGGAGGTGACCTGGGCCTGG + Intronic
900574716 1:3377369-3377391 CCCTGGACGGGGCCGGCGGCTGG + Intronic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900937110 1:5773441-5773463 CACTGCAAGGGTCCTGGGCCTGG - Intergenic
900998958 1:6137933-6137955 CCCTGGTGGGGGCCTGGACCTGG + Intronic
901536585 1:9886359-9886381 AACTGGAGGGGGGCTGCTACTGG - Intronic
901810932 1:11766467-11766489 CACGGGATGGGGCCTGAGTCTGG - Exonic
902759205 1:18570028-18570050 CCCAGGAGAGGGCCTGCGCCTGG - Intergenic
904043970 1:27599451-27599473 GAGTGGAGGGGGCCGGAGCCTGG - Intronic
904619027 1:31764379-31764401 CCCGGGAGGGGGCGCGCGCCGGG + Intronic
905182671 1:36176535-36176557 CACCGGAGCGGGGCTGCCCCCGG - Exonic
905259302 1:36706292-36706314 CACAGGATGGGACCTGTGCCAGG - Intergenic
905959993 1:42035623-42035645 CAGCTGAGGGGGCCGGCGCCCGG + Intronic
907371233 1:54004832-54004854 GACTGGTGGGGGACAGCGCCAGG - Intergenic
913332829 1:117681609-117681631 CACAGGAGGTGGGCTGCCCCTGG + Intergenic
915333318 1:155126755-155126777 CGGGGGAGGGGGCCTGAGCCGGG + Intergenic
916651544 1:166839250-166839272 CACTGGAAGCGGCCTGCATCGGG + Intergenic
924502869 1:244653213-244653235 CGCTTCAGGGGGCCTGAGCCGGG - Exonic
1063459095 10:6204061-6204083 CACCGGGGGGTGCGTGCGCCCGG - Intronic
1070800559 10:79242567-79242589 AACTGGAGGGGGCCTCGGCCGGG - Intronic
1070931767 10:80266009-80266031 CCCTGGAGGAGGCCAGGGCCAGG + Intergenic
1071065692 10:81633211-81633233 CACTGGAGAGGGCCAAAGCCAGG + Intergenic
1075857019 10:125638204-125638226 CACGGGGAGGGGCCTGCACCTGG - Intronic
1075897403 10:126008979-126009001 CACAGCAGGGGGCATGAGCCTGG - Intronic
1076627257 10:131829647-131829669 CCCTGGAGTGGGGCTGCCCCGGG - Intergenic
1076722693 10:132399658-132399680 CACTGGAGGCCGCCTGCTCCGGG - Intronic
1077114049 11:875120-875142 TTCAGGAGGGGGCCTGGGCCTGG - Intronic
1077200016 11:1302074-1302096 CCCTGCAAGGGGCCTGCTCCAGG + Intronic
1077896399 11:6456723-6456745 CACGGGAGAGGGCCTGCGCCAGG - Exonic
1080885384 11:36363038-36363060 CACTGGACCAGGCCTGAGCCTGG + Intronic
1082000015 11:47389142-47389164 CACTGGAGGGTGCCCGTGCTGGG + Intergenic
1083655366 11:64226685-64226707 CCCTGGCGGGGGCCTGCCCCAGG + Exonic
1083736953 11:64686816-64686838 CAGTGGAAGGGCCCTGTGCCGGG - Intronic
1084030399 11:66477593-66477615 CACTGCAGGGGCCCTGCGCAGGG - Intergenic
1084167354 11:67381852-67381874 GGCTGGAGGAGGCCTGCTCCAGG - Intronic
1084207692 11:67605465-67605487 CAAGAGAGGGGGCCTGCGGCTGG + Intronic
1085201535 11:74705138-74705160 CTCTGGATGGGGCCTGCTCTTGG - Intronic
1085739996 11:79070230-79070252 CACTGGAGGAGGCCTCCTCAAGG - Intronic
1087837852 11:102892552-102892574 CACTAGAGGAGGCCTGCTCAAGG + Intergenic
1089692146 11:120193495-120193517 CACTGTATGGGGCCTGTGCGGGG + Intergenic
1093406797 12:18814069-18814091 CATTGGATGTGGCCTGCTCCAGG - Intergenic
1096676286 12:53227804-53227826 CACTGCAAGGGCCCTGAGCCAGG - Intronic
1101549215 12:105746556-105746578 CATTGGTGGGGGACTGCTCCAGG - Intergenic
1102353999 12:112217072-112217094 CGCTGGGGGAGGCCTGCCCCGGG - Exonic
1103917630 12:124384207-124384229 CGCAGAAGGGGGCCTGGGCCGGG - Intronic
1104969382 12:132524303-132524325 CACTGGAGGAGGCCCTGGCCGGG - Intronic
1105522099 13:21140462-21140484 CACGGAAGTGCGCCTGCGCCAGG + Intergenic
1106004365 13:25755245-25755267 CAGTGGAGAGGGCCTGCCTCTGG - Intronic
1107605024 13:42048599-42048621 GCCTGGAGGGCGCCTGCCCCGGG + Intronic
1109906300 13:68846327-68846349 CACAGGAGGGGGACTGCCCAAGG + Intergenic
1109968770 13:69737670-69737692 CACTAGAGGGGGCCTCCCCATGG + Intronic
1113775614 13:112943419-112943441 CAACGGAGGGCGCCGGCGCCCGG + Intronic
1115456774 14:33613187-33613209 AACTGGAGGGCACCTGCTCCTGG + Intronic
1115893254 14:38056453-38056475 CACTGGAGGGGGCATGTGACAGG + Intergenic
1118303225 14:64633497-64633519 CACTGTAGGGTGGCTGGGCCGGG + Intergenic
1120621568 14:86771947-86771969 CACTGGTGGAGGGCTGCTCCTGG + Intergenic
1121410506 14:93745586-93745608 CCCAGGTGGGGGCCTGAGCCAGG - Intronic
1122210587 14:100171443-100171465 GACTGCAGGGGGCCTGCGAGGGG - Intergenic
1122643756 14:103177704-103177726 CCCTGGAGGGAGCCAGTGCCAGG + Intergenic
1123114935 14:105890353-105890375 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1123117122 14:105899801-105899823 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1123119204 14:105909111-105909133 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1123763032 15:23447039-23447061 CATGGGAGGGGGCCTGGGGCTGG + Intronic
1129737905 15:77976043-77976065 CCATGGATGGGGCCTGTGCCTGG + Intergenic
1131274496 15:90969493-90969515 CGCTGGAGGGGGGCCGAGCCAGG + Exonic
1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG + Intergenic
1132338554 15:101064122-101064144 CCCTGGCCGGGGCCTGAGCCAGG + Intronic
1132888679 16:2193957-2193979 GGCTGGAGGGGGCCGGGGCCAGG + Intronic
1132974670 16:2705395-2705417 GACTGGAGGGTGCCCGTGCCAGG + Intronic
1133076399 16:3283868-3283890 AGCTGGAGGAGGACTGCGCCTGG + Exonic
1134103498 16:11469435-11469457 CACTGCAGGGGCCCTGCCCCGGG + Intronic
1134550448 16:15136328-15136350 TACGGGAGGTGGCCTGCGCGGGG - Intronic
1135133413 16:19870823-19870845 CACTGGAAGGGCCCTGCCTCTGG - Intronic
1136048682 16:27635396-27635418 GACTGGAGGGGGCCGGCTCTCGG - Intronic
1138112034 16:54331326-54331348 CAGAGGAGGGGGGCTGCGACAGG - Intergenic
1139515314 16:67449233-67449255 CCCTGGAGGGGGCCTAGCCCAGG - Intronic
1139613460 16:68075124-68075146 CACTGGAGGGAGGCTGGGCTGGG - Intronic
1140478523 16:75250781-75250803 CGCGGGAGGGGGCCAGGGCCGGG - Intronic
1140880921 16:79197459-79197481 CACTGGAGGGGGGCAGTGCAGGG - Intronic
1141438258 16:84013171-84013193 CTCTCCAGGGGGCCTGAGCCAGG - Intronic
1141566710 16:84907257-84907279 CATTGAAGGGGGCCTGTGGCGGG - Exonic
1141959220 16:87392904-87392926 CTCTGAAGCGGGGCTGCGCCGGG + Intronic
1141991598 16:87614041-87614063 CAAGGGAGGGGCCCTGCCCCAGG + Intronic
1142110657 16:88329408-88329430 CCCTGGAGGGGGCTTCCGCTAGG - Intergenic
1142895591 17:2975729-2975751 CATGGGAGGGGGCTTGCCCCTGG + Intronic
1144770668 17:17757716-17757738 CACTGATGGGCGCCTGCGGCGGG - Intronic
1148051052 17:44770057-44770079 CACTGCAGGGGACCGGGGCCGGG + Intronic
1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG + Intronic
1150345218 17:64399326-64399348 AACTGGAGGGGGCCTCCTGCAGG - Intronic
1151404582 17:73878176-73878198 CACCGCAGGGGGGCTGCTCCAGG + Intergenic
1151877110 17:76873080-76873102 GAGTGGAGGGGGCCTGGGCTTGG + Intronic
1152044866 17:77929274-77929296 GACTGGAGAGGACCTGCGTCAGG - Intergenic
1152353230 17:79794838-79794860 CTCTGGGGGGGGCCTGTACCGGG - Exonic
1152357268 17:79813319-79813341 CCCGGGAGGGTCCCTGCGCCCGG + Intergenic
1152564719 17:81095189-81095211 GACTGGAGGGGGCCAGCCACTGG + Intronic
1154162991 18:11993819-11993841 CACTCGAGGGGGCTTGAGCCTGG + Intronic
1157610046 18:48950366-48950388 CTCTGGAGGAGCCGTGCGCCCGG - Exonic
1158544261 18:58382271-58382293 CCCTGGAGGTGGCCTCTGCCAGG + Intronic
1160100440 18:75915961-75915983 CAGAGGAGCGGGCCTGGGCCGGG - Intergenic
1160125457 18:76167661-76167683 CACGGGAGGGCGCCTGTGGCTGG - Intergenic
1160378296 18:78430058-78430080 CGCTGGAGGGGGCCGCCGGCTGG - Intergenic
1161464429 19:4420516-4420538 TACAGGTGGGAGCCTGCGCCTGG + Intronic
1162133615 19:8542418-8542440 CAGTGCAGGGGGCCTGTGTCAGG + Intronic
1162379048 19:10321242-10321264 CCTAGGAGGGGGCCTGCCCCCGG - Exonic
1163489704 19:17609885-17609907 CAAGGGAGGGGGCATCCGCCAGG - Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1164834873 19:31350186-31350208 CCCTGGAGGGGGCCTGCCCGTGG - Intergenic
1165360327 19:35332613-35332635 CCTGGGAGGGGGCCTGCGTCTGG + Exonic
1165448202 19:35868406-35868428 CCCGGGCGGGAGCCTGCGCCAGG - Intronic
1168410998 19:56140566-56140588 CTCAGGAGGGGGCCAGCGCGGGG - Intronic
925939009 2:8797158-8797180 CTCTGGAGGGGAGCTGCCCCAGG - Intronic
927851675 2:26503642-26503664 CACTGGGTGGGGCCTGGCCCTGG + Intronic
927883783 2:26706421-26706443 CAGTGGAGGGGGCCTCCCCTGGG - Intronic
930775419 2:55165710-55165732 CACTGGATGGGGGCTGCCACTGG - Intergenic
933720577 2:85395022-85395044 GACAGGAGGGGGCCAGAGCCAGG + Intronic
933765998 2:85710188-85710210 CCCTGGATGGGGCCAGCGCCTGG + Intergenic
935259849 2:101344627-101344649 CCCTGGAGATGGCCTGCTCCAGG + Intergenic
938036568 2:128039662-128039684 CTCTGGAGGGCTCTTGCGCCCGG + Intergenic
941256671 2:163241007-163241029 CACTGAAGTGGGCCTGTGACTGG + Intergenic
941935070 2:170975587-170975609 CACTGCAGGGGCCATGCACCTGG + Intergenic
943011803 2:182459334-182459356 CACTGGAGGGAGCCTTCTCAAGG - Intronic
943712852 2:191117071-191117093 CTCTGGAGTGGGGCTGCGCATGG + Intronic
944485081 2:200197016-200197038 CACTGGCAGGGGCCAGAGCCTGG + Intergenic
948032876 2:234833852-234833874 TCCTGGAAGGGGCCTGTGCCTGG + Intergenic
948076983 2:235172534-235172556 CCCTGGAGGGGGCCTAGGCGTGG + Intergenic
948414703 2:237794560-237794582 CAGTTGAGGGGGCCTCTGCCAGG + Intronic
948465709 2:238150687-238150709 CCCTGGAGGGGATCTGGGCCAGG + Intronic
948792224 2:240385042-240385064 CACTGGCCGTGACCTGCGCCTGG + Intergenic
1172550048 20:35791988-35792010 CAGTGGAAAGGGCCTGTGCCAGG - Intronic
1172787426 20:37478402-37478424 CACTGGAGGGTGTCTGGGCTTGG + Intergenic
1173139661 20:40470954-40470976 CTCTGGCAGGGGCCTGAGCCGGG - Intergenic
1175119661 20:56708251-56708273 AAGTGGAGGGGGCCTAGGCCAGG + Intergenic
1175516915 20:59575896-59575918 CAGTGCAGGGGGCCTGCGGAAGG + Intergenic
1175919037 20:62441469-62441491 CCCTGGAGGGTGCCTGGCCCAGG + Intergenic
1175952648 20:62591538-62591560 CTCTGGTGGGGGCCTGGGGCTGG - Intergenic
1176770690 21:13069973-13069995 CACGGGAGGGGGTATGTGCCAGG + Intergenic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1179792245 21:43762467-43762489 GATGGGAGGGGGCCTGGGCCCGG - Intergenic
1179829689 21:43988901-43988923 CACTGCAGGCGGCCTGCACCTGG + Intergenic
1180050225 21:45327681-45327703 CAGGGGAGTGGGCCTGGGCCAGG + Intergenic
1180207979 21:46274116-46274138 CACTGTAGGGCCCCTGCCCCAGG - Intronic
1180868418 22:19132917-19132939 CACTGGAGCTGGCCAGCCCCAGG - Exonic
1182063827 22:27416707-27416729 GACAGCAGGGGGCCTGCTCCCGG + Intergenic
1183367167 22:37412887-37412909 CCCAGGAGTGGGCCTGGGCCAGG + Intronic
1183582547 22:38734544-38734566 CACTGGAGGAGACCTGCCTCAGG + Intronic
1184043189 22:41956639-41956661 CCCTGGATGGGGCCTGTGCAGGG - Intergenic
1184089564 22:42285102-42285124 GCCTGGAGGGGCCCTGGGCCAGG - Intronic
1184391179 22:44204551-44204573 GGCTGGAGGTGGCCTGGGCCAGG + Intronic
1184691538 22:46119515-46119537 CACTGGAGGGTGCCTCCCCCCGG - Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
952212442 3:31241759-31241781 CACTGGATGAGGGCTGCCCCAGG - Intergenic
952966160 3:38622540-38622562 CGCTGGGGGGGTCCTGCCCCTGG + Intronic
953021043 3:39113469-39113491 CACTGGAGGTGGGCTGCCCCAGG + Intronic
953717190 3:45325846-45325868 CACAGGAGGGGGCATGACCCCGG - Intergenic
962808874 3:138945705-138945727 CACTGGTGGGCGCGGGCGCCGGG + Exonic
963091515 3:141487324-141487346 CCCGGGAGGGGGCCTGGGCCGGG + Intronic
963536616 3:146537432-146537454 CACTGGAGTGGGCCTGGGAAGGG - Intronic
967927494 3:194662864-194662886 CACTGTAGGGTGCCTGGGCAGGG - Intronic
968923687 4:3535888-3535910 CTCTGGAGGGAGCCAGCGCAAGG + Intergenic
968968428 4:3781179-3781201 CTCTGGACGTGGCCTGAGCCGGG + Intergenic
976076254 4:81302309-81302331 CACTGGAAGGAGCCTGTCCCGGG + Intergenic
976800291 4:88982945-88982967 CACTGGAGGTGAGCTGTGCCAGG - Intronic
981582308 4:146261882-146261904 CGCTGGAGTGGGCCTCCCCCTGG - Intronic
985627080 5:994723-994745 CACTGCATGGGGCCTGGGCATGG - Intergenic
985728051 5:1525959-1525981 CACTAGAGAGGACCTGCTCCAGG - Intergenic
985783815 5:1883940-1883962 CAGGGGAGGGCGCCTCCGCCAGG - Intronic
986632063 5:9783398-9783420 CTCTGGATGGGGCCTTCTCCAGG - Intergenic
987001510 5:13664716-13664738 CATTGGATGGGACCTGAGCCAGG + Intergenic
987032241 5:13986707-13986729 CAGTGAAAGGGGCCTGGGCCAGG - Intergenic
997295945 5:132768490-132768512 CACTCCAGGGTGCCTGCTCCAGG + Intronic
997717496 5:136052994-136053016 CACTGGAGGTGGGCTGCAGCGGG + Exonic
999616255 5:153427728-153427750 CACTGGAGGGGGTCTGGGACAGG + Intergenic
1002454908 5:179340325-179340347 CACTGGTGGGGGACTGCAGCTGG - Intronic
1002714764 5:181220036-181220058 TACAGGAGGCGGCCGGCGCCGGG - Intergenic
1004497961 6:16182189-16182211 TGCTGCAGGGGGCCTGCCCCAGG - Intergenic
1006372705 6:33655313-33655335 CACTGGATAGGGGCTGCCCCTGG + Intronic
1006788601 6:36684274-36684296 CACTGGAGGGTGACTTCGCCTGG + Exonic
1006792835 6:36714892-36714914 CACTGCAGGGGCCCTGAGGCAGG - Intronic
1007509553 6:42364730-42364752 CACTGGTGGGGGCTTATGCCTGG - Intronic
1014778071 6:125533543-125533565 CTCTGGAGGTGGCCTGGGGCAGG - Intergenic
1019324679 7:432293-432315 CAGTGGACTGGGCCTGCACCAGG + Intergenic
1019381657 7:727296-727318 CACCGGGCGTGGCCTGCGCCAGG - Exonic
1019651840 7:2163766-2163788 CCCTGGAGGCAGCCTGGGCCTGG + Intronic
1021307942 7:19054341-19054363 CACTGGAGGTGGTCTGCCCTGGG + Intronic
1024895713 7:54259420-54259442 CACTGGAGGTGGGCTGCCTCTGG + Intergenic
1027540078 7:79454476-79454498 CGCGGGCGGGGGCCTGCCCCGGG - Intergenic
1032119329 7:129144995-129145017 CCCCGGAGGCGGCCGGCGCCCGG - Exonic
1035751663 8:2001279-2001301 GACTGCAGGGTGTCTGCGCCGGG - Exonic
1036695787 8:10974288-10974310 CACCTGAGAGGGCCTGTGCCTGG + Intronic
1040549779 8:48429140-48429162 TGCTGGAGGGGCCCTGGGCCAGG + Intergenic
1040630973 8:49209884-49209906 CACCAGAAGGGGCCTGGGCCTGG + Intergenic
1041698858 8:60765706-60765728 CACTGGTGCGGGGCTGCCCCCGG - Intronic
1042102154 8:65285084-65285106 CAGAGGAGGGGGCCCCCGCCTGG - Intergenic
1045304905 8:100950940-100950962 AACTGGAGGGTCCCTGCGCTCGG - Intronic
1046907250 8:119586974-119586996 CACAGGAGGGAGGCTGCTCCAGG + Intronic
1048823393 8:138400013-138400035 CTCTGCAGGGGGCCTGGGACTGG - Intronic
1048872465 8:138810817-138810839 AACTGGAGTGGGCCTGCTCTGGG - Intronic
1049282770 8:141758948-141758970 CAGTGGAGGGGTCCAGAGCCTGG + Intergenic
1049306720 8:141907927-141907949 CACTGGAGGCTTCCTGCCCCAGG - Intergenic
1049604756 8:143524125-143524147 CACTGCAGGGGCACTGTGCCCGG - Intronic
1049668560 8:143859503-143859525 CCCTGGAGGGCGCCCGAGCCTGG + Exonic
1049668976 8:143861105-143861127 CCCTGGAGGGCGCCCGAGCCTGG + Exonic
1049669391 8:143862707-143862729 CCCTGGAGGGCGCCCGAGCCTGG + Exonic
1049669802 8:143864300-143864322 CCCTGGAGGGCGCCCGAGCCTGG + Exonic
1049670218 8:143865908-143865930 CCCTGGAGGGCGCCCGAGCCTGG + Exonic
1049832944 8:144713677-144713699 CACTGGAAGAGGCGCGCGCCAGG - Intergenic
1053799398 9:41754910-41754932 CTCTGGAGGGAGCCAGCGCAAGG + Intergenic
1054145818 9:61560087-61560109 CTCTGGAGGGAGCCAGCGCAAGG - Intergenic
1054650707 9:67621610-67621632 CTCTGGAGGGAGCCAGCGCAAGG - Intergenic
1056457141 9:86771605-86771627 CATTGGAGGTGGGCTGCCCCTGG + Intergenic
1057247189 9:93466584-93466606 CACTGGTGGGGTCCTGCTGCTGG + Intronic
1057817051 9:98303605-98303627 GAGGGGAGGGGGCCTGCCCCAGG - Intronic
1060057909 9:120431606-120431628 GTCTGGAGGGGGCCTTTGCCAGG - Intronic
1060995449 9:127872959-127872981 CACTGGAGGGAGCCCGGGCCTGG - Intronic
1061042892 9:128149977-128149999 CACTGGAGGAGGCATGTGGCTGG - Intronic
1061242457 9:129382532-129382554 CTCTGAAGGAGGCCTGAGCCAGG - Intergenic
1061423839 9:130486991-130487013 AACTGGAGGGGGAATGGGCCCGG - Intronic
1061815099 9:133189972-133189994 CAGTAGCGGGGGCCTGAGCCAGG + Intergenic
1061886444 9:133593402-133593424 CAGTGGAGGTGGCCTGGGCTGGG - Intergenic
1061946091 9:133908780-133908802 CTCCCGAGGGGGCCTGCTCCTGG - Intronic
1062102717 9:134736940-134736962 CACTGGAGGGAGGCGGCCCCAGG + Intronic
1062123729 9:134848395-134848417 CCCTGGAGCTGGCCTGTGCCAGG + Intergenic
1062278683 9:135742451-135742473 CACAGGAGGGTGCATGCGCGGGG + Intronic
1062389150 9:136327297-136327319 CAGGGGAGAGGGCCTGGGCCTGG - Intergenic
1185778865 X:2829013-2829035 CAGTGGAGGAGGCCTGGGCGCGG + Intronic
1187365384 X:18662023-18662045 TACTGGAGGGGGGCAGCGCGTGG - Intronic
1190131210 X:47750514-47750536 CATTGGATGGGGACTGCCCCAGG + Intergenic
1190474268 X:50812363-50812385 CACTGGAGGGAGACTGCCTCAGG + Intronic
1192227332 X:69238396-69238418 CACTGGAGGGGGCATGCAAGGGG - Intergenic
1192503084 X:71665840-71665862 CACTGCAGGGGCCCTGCCCTGGG - Intergenic
1192529411 X:71872359-71872381 CGCTGGAGGGGCCCTGCCCCGGG - Intergenic
1200003612 X:153074081-153074103 CACAGGAAGGGGCCGGTGCCCGG + Exonic
1200004111 X:153075928-153075950 CACAGGAAGGGGCCGGTGCCCGG - Intergenic
1201291159 Y:12421491-12421513 CAGTGGAGGAGGCCTGGGCGCGG - Intergenic