ID: 1148535458

View in Genome Browser
Species Human (GRCh38)
Location 17:48434839-48434861
Sequence ATTACTATTTAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148535458_1148535474 30 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535474 17:48434892-48434914 GCAGGGGGATCACTTGAGGCAGG 0: 5
1: 214
2: 2204
3: 12381
4: 65154
1148535458_1148535462 -2 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535462 17:48434860-48434882 ATGTTTCATTCCCAGCACTTTGG No data
1148535458_1148535464 2 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535464 17:48434864-48434886 TTCATTCCCAGCACTTTGGGAGG No data
1148535458_1148535463 -1 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535463 17:48434861-48434883 TGTTTCATTCCCAGCACTTTGGG No data
1148535458_1148535470 14 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535470 17:48434876-48434898 ACTTTGGGAGGCCGAGGCAGGGG 0: 536
1: 2409
2: 4093
3: 5066
4: 6671
1148535458_1148535468 12 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535468 17:48434874-48434896 GCACTTTGGGAGGCCGAGGCAGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1148535458_1148535473 26 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535473 17:48434888-48434910 CGAGGCAGGGGGATCACTTGAGG 0: 52
1: 4584
2: 30840
3: 75574
4: 108726
1148535458_1148535466 8 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535466 17:48434870-48434892 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1148535458_1148535469 13 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535469 17:48434875-48434897 CACTTTGGGAGGCCGAGGCAGGG 0: 551
1: 2315
2: 3920
3: 4942
4: 6945
1148535458_1148535471 15 Left 1148535458 17:48434839-48434861 CCCTCCTCCATCTAAATAGTAAT No data
Right 1148535471 17:48434877-48434899 CTTTGGGAGGCCGAGGCAGGGGG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148535458 Original CRISPR ATTACTATTTAGATGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr