ID: 1148536375

View in Genome Browser
Species Human (GRCh38)
Location 17:48442475-48442497
Sequence TAGCAGAGTCCCAGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148536375_1148536381 15 Left 1148536375 17:48442475-48442497 CCATCCTGCCTGGGACTCTGCTA No data
Right 1148536381 17:48442513-48442535 TTTTGGATGTGAAATGTGCAGGG No data
1148536375_1148536380 14 Left 1148536375 17:48442475-48442497 CCATCCTGCCTGGGACTCTGCTA No data
Right 1148536380 17:48442512-48442534 TTTTTGGATGTGAAATGTGCAGG No data
1148536375_1148536382 18 Left 1148536375 17:48442475-48442497 CCATCCTGCCTGGGACTCTGCTA No data
Right 1148536382 17:48442516-48442538 TGGATGTGAAATGTGCAGGGTGG No data
1148536375_1148536379 -2 Left 1148536375 17:48442475-48442497 CCATCCTGCCTGGGACTCTGCTA No data
Right 1148536379 17:48442496-48442518 TATACTTGGTGTTACATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148536375 Original CRISPR TAGCAGAGTCCCAGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr