ID: 1148536770

View in Genome Browser
Species Human (GRCh38)
Location 17:48445550-48445572
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148536770_1148536774 24 Left 1148536770 17:48445550-48445572 CCGCAGTCTTTCTGCAGAGATCT No data
Right 1148536774 17:48445597-48445619 CACAGGGCCTTACACATAGTAGG No data
1148536770_1148536772 8 Left 1148536770 17:48445550-48445572 CCGCAGTCTTTCTGCAGAGATCT No data
Right 1148536772 17:48445581-48445603 TCTTCTGCTTTGCATCCACAGGG No data
1148536770_1148536771 7 Left 1148536770 17:48445550-48445572 CCGCAGTCTTTCTGCAGAGATCT No data
Right 1148536771 17:48445580-48445602 TTCTTCTGCTTTGCATCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148536770 Original CRISPR AGATCTCTGCAGAAAGACTG CGG (reversed) Intergenic
No off target data available for this crispr