ID: 1148536772

View in Genome Browser
Species Human (GRCh38)
Location 17:48445581-48445603
Sequence TCTTCTGCTTTGCATCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148536768_1148536772 10 Left 1148536768 17:48445548-48445570 CCCCGCAGTCTTTCTGCAGAGAT No data
Right 1148536772 17:48445581-48445603 TCTTCTGCTTTGCATCCACAGGG No data
1148536767_1148536772 11 Left 1148536767 17:48445547-48445569 CCCCCGCAGTCTTTCTGCAGAGA No data
Right 1148536772 17:48445581-48445603 TCTTCTGCTTTGCATCCACAGGG No data
1148536770_1148536772 8 Left 1148536770 17:48445550-48445572 CCGCAGTCTTTCTGCAGAGATCT No data
Right 1148536772 17:48445581-48445603 TCTTCTGCTTTGCATCCACAGGG No data
1148536769_1148536772 9 Left 1148536769 17:48445549-48445571 CCCGCAGTCTTTCTGCAGAGATC No data
Right 1148536772 17:48445581-48445603 TCTTCTGCTTTGCATCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148536772 Original CRISPR TCTTCTGCTTTGCATCCACA GGG Intergenic
No off target data available for this crispr