ID: 1148536774

View in Genome Browser
Species Human (GRCh38)
Location 17:48445597-48445619
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148536767_1148536774 27 Left 1148536767 17:48445547-48445569 CCCCCGCAGTCTTTCTGCAGAGA No data
Right 1148536774 17:48445597-48445619 CACAGGGCCTTACACATAGTAGG No data
1148536770_1148536774 24 Left 1148536770 17:48445550-48445572 CCGCAGTCTTTCTGCAGAGATCT No data
Right 1148536774 17:48445597-48445619 CACAGGGCCTTACACATAGTAGG No data
1148536769_1148536774 25 Left 1148536769 17:48445549-48445571 CCCGCAGTCTTTCTGCAGAGATC No data
Right 1148536774 17:48445597-48445619 CACAGGGCCTTACACATAGTAGG No data
1148536768_1148536774 26 Left 1148536768 17:48445548-48445570 CCCCGCAGTCTTTCTGCAGAGAT No data
Right 1148536774 17:48445597-48445619 CACAGGGCCTTACACATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148536774 Original CRISPR CACAGGGCCTTACACATAGT AGG Intergenic
No off target data available for this crispr