ID: 1148542628

View in Genome Browser
Species Human (GRCh38)
Location 17:48492618-48492640
Sequence GGACGAAGGCGCGCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148542620_1148542628 11 Left 1148542620 17:48492584-48492606 CCTGCGTGAGATAGTGAGAGGGA No data
Right 1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148542628 Original CRISPR GGACGAAGGCGCGCCCGGAG AGG Intergenic
No off target data available for this crispr