ID: 1148544173

View in Genome Browser
Species Human (GRCh38)
Location 17:48504281-48504303
Sequence CCTAACCTGGCCAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148544173_1148544180 -3 Left 1148544173 17:48504281-48504303 CCTTTCACCTTGGCCAGGTTAGG No data
Right 1148544180 17:48504301-48504323 AGGGCCAATTAAGGGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148544173 Original CRISPR CCTAACCTGGCCAAGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr