ID: 1148544335

View in Genome Browser
Species Human (GRCh38)
Location 17:48505580-48505602
Sequence ATCTAGTTATTTTGGTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148544331_1148544335 25 Left 1148544331 17:48505532-48505554 CCACTTTTATATCATGCAAACTG No data
Right 1148544335 17:48505580-48505602 ATCTAGTTATTTTGGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148544335 Original CRISPR ATCTAGTTATTTTGGTCACA AGG Intergenic
No off target data available for this crispr