ID: 1148546559

View in Genome Browser
Species Human (GRCh38)
Location 17:48523725-48523747
Sequence TAGAAGATGGATAAGAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148546559_1148546564 9 Left 1148546559 17:48523725-48523747 CCAGACTTCTTATCCATCTTCTA No data
Right 1148546564 17:48523757-48523779 AGAGAGGGAATGAGTGTGAGAGG No data
1148546559_1148546562 -7 Left 1148546559 17:48523725-48523747 CCAGACTTCTTATCCATCTTCTA No data
Right 1148546562 17:48523741-48523763 TCTTCTATAATGGAGAAGAGAGG No data
1148546559_1148546563 -6 Left 1148546559 17:48523725-48523747 CCAGACTTCTTATCCATCTTCTA No data
Right 1148546563 17:48523742-48523764 CTTCTATAATGGAGAAGAGAGGG No data
1148546559_1148546565 14 Left 1148546559 17:48523725-48523747 CCAGACTTCTTATCCATCTTCTA No data
Right 1148546565 17:48523762-48523784 GGGAATGAGTGTGAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148546559 Original CRISPR TAGAAGATGGATAAGAAGTC TGG (reversed) Intergenic
No off target data available for this crispr