ID: 1148547351

View in Genome Browser
Species Human (GRCh38)
Location 17:48528501-48528523
Sequence ATGGAGAAACAGAAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 767}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148547344_1148547351 15 Left 1148547344 17:48528463-48528485 CCACGGTGCACGGAGTATGAGGC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG 0: 1
1: 0
2: 2
3: 74
4: 767
1148547346_1148547351 -7 Left 1148547346 17:48528485-48528507 CCTCTTCTACCCCTGAATGGAGA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG 0: 1
1: 0
2: 2
3: 74
4: 767
1148547342_1148547351 23 Left 1148547342 17:48528455-48528477 CCTCTTCTCCACGGTGCACGGAG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG 0: 1
1: 0
2: 2
3: 74
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148547351 Original CRISPR ATGGAGAAACAGAAGCAGGC AGG Intergenic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
900982501 1:6054332-6054354 ATGAAGCAACAAAAGCAGCCGGG + Intronic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
901662468 1:10807160-10807182 ATGGAAAGATAGAAGCTGGCTGG - Intergenic
901792469 1:11661587-11661609 AGGGAGAGACAGATCCAGGCTGG - Exonic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
903739414 1:25549949-25549971 AGGGAGAAACAGGACCAGACTGG + Intronic
903882258 1:26519048-26519070 GAGGAGGAACAGAAGCATGCAGG - Intergenic
904075844 1:27841774-27841796 ATGGAAGAACAAAAGCAGTCTGG - Intronic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
904946978 1:34206557-34206579 ACATAGAAACAGAAACAGGCAGG + Intronic
904967826 1:34392459-34392481 GTAGAGAGAAAGAAGCAGGCTGG - Intergenic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905253058 1:36662107-36662129 ATGGACAAACAGAGGCTGGGAGG - Intergenic
905392063 1:37642622-37642644 AAGGACAAAAAGGAGCAGGCAGG - Intergenic
905486364 1:38299758-38299780 ATGGAGAAATGGAGGCAGGGAGG + Intergenic
906165251 1:43681281-43681303 AAGGAGACTCAGAAGCAGACAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
907736559 1:57118559-57118581 ATGGAGAGAATGTAGCAGGCAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908046607 1:60177144-60177166 ATGGTGAATCAGAAGAAGCCAGG + Intergenic
908316886 1:62941498-62941520 ATGGGGAGAAAGAAGCAGGCAGG - Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
910017422 1:82544379-82544401 ATGAAGAAACAGAACAAAGCTGG + Intergenic
910247457 1:85155340-85155362 GTCGAGAAATAAAAGCAGGCTGG + Intergenic
910861641 1:91747962-91747984 CTAGAGAAACAGAACCAGTCGGG - Intronic
910979621 1:92946645-92946667 ATCAAGAAACAGAGGTAGGCTGG + Intronic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
911945747 1:104106615-104106637 TGGGAGAAAAAGAAGCAGGATGG - Intergenic
912178843 1:107193293-107193315 TTGGAGAAACAGCAGCAAGTAGG - Intronic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
915017016 1:152743807-152743829 AAAGAGAGACAGAAGAAGGCAGG + Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916800925 1:168215817-168215839 AAAAAGAAAAAGAAGCAGGCTGG + Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917965688 1:180177108-180177130 ATTGAGAAATAGAAGCAGCAAGG - Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918197346 1:182234695-182234717 AGGGAGAAAGCGAAGCAGGGAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919798606 1:201337067-201337089 ATGGGGAGACAGAGGCAGCCCGG + Intergenic
919811145 1:201409527-201409549 ATGGTGCAACAGAAGCATGGAGG - Intronic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919853812 1:201692191-201692213 GTGGATATAGAGAAGCAGGCAGG + Intronic
920052915 1:203174354-203174376 ATGGAGAAACTGAGGCCAGCAGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920197982 1:204242178-204242200 ATGAGCAAACAGAACCAGGCGGG + Intronic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921308799 1:213822722-213822744 TTGGAGAAAGAGAAGAAGCCAGG - Intergenic
921310647 1:213839773-213839795 ATGAAGAAACTGAAGCATGGAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922098236 1:222460745-222460767 AGAGAGACACAGAAGCAGACGGG + Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922668002 1:227489118-227489140 ATGGAGGAACATACGCATGCAGG + Intergenic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923089511 1:230729126-230729148 GTGGAGAAACTGCACCAGGCAGG - Intergenic
923484627 1:234416905-234416927 GTGCAGAAAGAGAAGCAGACAGG + Intronic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
924238095 1:242015795-242015817 ATGGAGAAAAAGGGGAAGGCAGG + Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063566965 10:7179772-7179794 TGGGGGAAACAGAACCAGGCTGG + Intronic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065208328 10:23378350-23378372 ATGAGGAAACTGAAGCATGCAGG + Intergenic
1065971841 10:30811965-30811987 ATGTAGTAACTGATGCAGGCTGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1068939606 10:62668119-62668141 AGAGAGAGACAAAAGCAGGCCGG + Intronic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070085921 10:73237007-73237029 ATGTAAAGACAGAGGCAGGCTGG - Intronic
1070110148 10:73478079-73478101 AAGGAGAAACAGAAGCACTAGGG + Intronic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1070219873 10:74430044-74430066 ATGAAGAAACAGAGGCACGGAGG + Intronic
1070223985 10:74481512-74481534 ATGGTGAAACACAAACTGGCTGG - Intronic
1070806573 10:79274445-79274467 AGGGACAGACAGAGGCAGGCAGG - Intronic
1070992408 10:80744122-80744144 ATTGAAAAAGAGAAGTAGGCTGG + Intergenic
1071480532 10:86061669-86061691 CAGGAGGGACAGAAGCAGGCTGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072885917 10:99273748-99273770 ATAGACAAACAGATGCAGGGAGG + Intergenic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074524596 10:114252893-114252915 ATGAAGGAACACAAGCAGGCCGG - Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075044123 10:119132761-119132783 ATGGACAAGCAGGTGCAGGCTGG + Intronic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076854221 10:133108040-133108062 GTGGAGAAAGGGAAGAAGGCTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077261291 11:1622294-1622316 ATTTAGAAACATAAGCAGGTGGG - Intergenic
1078027271 11:7709060-7709082 AGGGAGAATGAGAAGCAGACAGG - Intergenic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080266476 11:30407065-30407087 AGGGAGAAACGGAAGCTGGGAGG - Intronic
1080583288 11:33660606-33660628 ATGTAGCAACAGAGGCAGGTGGG - Intronic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1081152878 11:39653329-39653351 ATGCAGAAAAAGAAGCACGGTGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083434727 11:62634562-62634584 AAGGAGACACAGACCCAGGCAGG + Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084413714 11:69018289-69018311 AAGGCGGGACAGAAGCAGGCGGG - Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084771036 11:71343208-71343230 ATACTGAAGCAGAAGCAGGCAGG + Intergenic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085069078 11:73525499-73525521 CTGGAGAAATAAAATCAGGCAGG - Intronic
1085389659 11:76175931-76175953 ATGGAGAAACAGAAGCCCACGGG + Intergenic
1085798256 11:79563628-79563650 ATGAAGAAACTGAAGCAGAGAGG + Intergenic
1087749304 11:101989661-101989683 AAGGAAACACAGAAACAGGCCGG + Intronic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1089387432 11:118077480-118077502 ATGGAGGAAGAGAGGAAGGCAGG - Intronic
1089626046 11:119751692-119751714 ATGCAGAGAAGGAAGCAGGCAGG - Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1089830608 11:121324318-121324340 ATGAAGTAACAGGAGCAGGCAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090246615 11:125220685-125220707 ATGGAGAAATAGAACAAGGCCGG - Intronic
1090297172 11:125598902-125598924 ATCAAGAAACAAAAGTAGGCTGG - Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1091033218 11:132210237-132210259 ATGAAGAAACAGAAGAGTGCTGG + Intronic
1091192798 11:133708355-133708377 ATGCAGAAACAGAAGCACAGAGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1092037193 12:5346764-5346786 ATGAAGAAACGTAAGCAGGTTGG + Intergenic
1092119835 12:6036239-6036261 ATGGAGAAACACAGGCACGGAGG + Intronic
1092463688 12:8709449-8709471 ATTGAGGGGCAGAAGCAGGCAGG + Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093612519 12:21179772-21179794 ATGGAGATAAAGAAGCGGGAAGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094165491 12:27438726-27438748 ATGGCCACACAGAAGCAAGCTGG + Intergenic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095461892 12:42452609-42452631 ATAAAGAAAAAGCAGCAGGCCGG + Intronic
1096115958 12:49055302-49055324 ATGGACAGCCAGAAGCTGGCTGG - Exonic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097264841 12:57738792-57738814 ATGGAGATACAGGAGGCGGCGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1098503714 12:71224765-71224787 AGAGAAAAACAGAATCAGGCTGG - Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099604889 12:84791252-84791274 TTGGAGATACAGAAGCAGTTGGG + Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099783889 12:87236447-87236469 TGGGAGAAAAAAAAGCAGGCCGG + Intergenic
1101075719 12:101127622-101127644 TTGGGGAAATAGAAACAGGCAGG - Intronic
1102350120 12:112185627-112185649 ATGGAGAAACAGAGGTTGGGAGG + Intronic
1103676995 12:122663662-122663684 ATGAAGAAAGAAAAACAGGCCGG - Intergenic
1104795496 12:131514333-131514355 ATGGTGACATAGAAGCAAGCTGG + Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1105627337 13:22125568-22125590 ATGGAAAAACAGAAGAAAACAGG + Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105778067 13:23681003-23681025 ATGCAGAACCAGCTGCAGGCAGG - Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107515964 13:41129959-41129981 ATGAAGAAAAAAATGCAGGCTGG - Exonic
1108071251 13:46630923-46630945 AGGCAGAACCAGAAGCAAGCTGG - Intronic
1108695063 13:52895916-52895938 AAGGAGGAGCAGAAGCTGGCTGG - Intergenic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1110856750 13:80304866-80304888 ATGGAGAAATAGAAGCACTGAGG + Intergenic
1111616087 13:90663424-90663446 ATGAAGTAACCGAAGCAGGAAGG - Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1114619607 14:24087411-24087433 ATGGGGAAAGAGGGGCAGGCAGG + Intronic
1114799403 14:25755968-25755990 ATGGAGAAATAGAAGAATGCTGG - Intergenic
1115342780 14:32309922-32309944 ATGCAGAAAACTAAGCAGGCAGG - Intergenic
1115457361 14:33618913-33618935 ATGTAGAAAGAGAAGCAGTGAGG + Intronic
1115547825 14:34479003-34479025 TTAAAGAGACAGAAGCAGGCTGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115955834 14:38778088-38778110 ATGGCAACACAGAAGCAAGCTGG + Intergenic
1116399351 14:44486363-44486385 CTGCAGAGAAAGAAGCAGGCTGG - Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116750962 14:48882943-48882965 AGTGAGAGACAGCAGCAGGCTGG + Intergenic
1117583121 14:57172808-57172830 ATTAAAAAACAGAAACAGGCCGG - Intergenic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117772217 14:59145229-59145251 GTGGAGAAAGAGGAGTAGGCAGG + Intergenic
1118375534 14:65173664-65173686 AAGGAAAATCAGAAGCAGACAGG + Intergenic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1118788509 14:69067235-69067257 ATGGTGGAACACAAGCATGCAGG + Intronic
1118841527 14:69516984-69517006 ATGGAGAAAAGGATGAAGGCGGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119583319 14:75807602-75807624 ATGAAGAAATAGAAGCTGGTAGG + Intronic
1119688424 14:76651834-76651856 AGGGAGATACAGATGCTGGCTGG - Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119742384 14:77022591-77022613 ATGAAGAGACAGTTGCAGGCCGG + Intergenic
1120745387 14:88147022-88147044 GTGGGGAACCGGAAGCAGGCAGG + Intergenic
1120982306 14:90300922-90300944 AAGGAGGAACACAGGCAGGCAGG + Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122024782 14:98867839-98867861 ATGGAGGAGCACAGGCAGGCTGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122428675 14:101626358-101626380 ATCGTGAAACACAGGCAGGCTGG - Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123973314 15:25528863-25528885 ATTGAGGAAAGGAAGCAGGCGGG + Intergenic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125533694 15:40430254-40430276 ATGGAGAAACAGGAGGACCCAGG + Intronic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126675106 15:51154224-51154246 AAGGTGAAACAGGAGCAGACAGG + Intergenic
1126807443 15:52365569-52365591 GTGAAGCAATAGAAGCAGGCAGG - Intronic
1126815794 15:52452092-52452114 ATGGTGGCACAGAAGCAAGCTGG + Intronic
1126838997 15:52697381-52697403 GTGGAGAAAGAGAGGCAAGCGGG - Intronic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127495047 15:59502878-59502900 TTGTAAAAAAAGAAGCAGGCTGG - Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128994769 15:72288452-72288474 CTGGAGGAACAGTAGCAAGCTGG + Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131126356 15:89860843-89860865 ATAGAGAAACAGAGGCAGCCAGG + Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131533043 15:93211057-93211079 ATGGAACAACACCAGCAGGCAGG + Intergenic
1131610450 15:93955695-93955717 ATGGTGAAACTGAGTCAGGCAGG - Intergenic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133258917 16:4536008-4536030 ATGGAGAGAGAGAGCCAGGCCGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133640755 16:7714999-7715021 ATGCAGAAATAGAGGCTGGCTGG + Intergenic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135470397 16:22724268-22724290 ATGGATAAACATCAGCAGGTAGG + Intergenic
1135627288 16:24007134-24007156 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1135711185 16:24718738-24718760 ATTGAGAGAGATAAGCAGGCTGG + Intergenic
1136099161 16:27980584-27980606 ATGAAGAAACTGAGGCTGGCTGG + Intronic
1137033248 16:35544169-35544191 ATGGAGATGGAGAAGCAGTCAGG - Intergenic
1137574990 16:49593636-49593658 ATGGAGAAACAAAGGCACGGAGG - Intronic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1137740230 16:50763057-50763079 ATGCAGAGACAGAAGTAGACTGG - Intronic
1137765409 16:50973965-50973987 ATGGAGAAATTGGAGCAGCCAGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137934091 16:52617218-52617240 ATGGAGAAAAAGAAAAAGCCAGG + Intergenic
1138133884 16:54504760-54504782 AAGGAGAAAAAGAAGCCGGTGGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1139128460 16:64110894-64110916 ATGGTGAATCAGAAGAAAGCTGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1140357121 16:74316015-74316037 ATGAAAAAATATAAGCAGGCCGG + Intergenic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141617267 16:85217102-85217124 ATGGGGAAACGGAAGCAGAAAGG - Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1142393608 16:89818029-89818051 ATCGAGAAATTGAAACAGGCTGG + Intergenic
1142911697 17:3098605-3098627 CTGGAGAAGCAGCAGCACGCTGG - Intergenic
1143855327 17:9843996-9844018 ATGGGGAAACTGATGCAGACAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143975997 17:10830233-10830255 ATCTATAAACAGAAGCAGGCAGG + Intronic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144535812 17:16090120-16090142 CTGAAGAAACTGAACCAGGCTGG - Intronic
1145082041 17:19902220-19902242 ATGGACAAACAGAAGCATGTGGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146571277 17:33955460-33955482 TTCCAGGAACAGAAGCAGGCAGG - Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147037778 17:37694523-37694545 TTGGAGGAACAGAAGAAGACAGG + Intronic
1147041329 17:37721594-37721616 ATGGGAAAAGAGAAGCAGCCGGG - Intronic
1147055406 17:37830545-37830567 AGGGGGAAAGAGTAGCAGGCAGG + Intergenic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148161512 17:45453048-45453070 AAGAAGAAAATGAAGCAGGCTGG + Intronic
1148329885 17:46807505-46807527 AAAAAGAAACAGAAGCAGACTGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1150392748 17:64799693-64799715 AAGAAGAAAATGAAGCAGGCTGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1151754885 17:76068563-76068585 ATGGAGAAAGAACTGCAGGCAGG + Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1153002597 18:469533-469555 GTTGAGAAATAGAAGCAAGCAGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153336942 18:3934470-3934492 ATGGAGAGAGAGAGGGAGGCAGG + Intronic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1154940769 18:21111276-21111298 GTAGAGAAAGAGAAGCAGGGTGG + Exonic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155302850 18:24448140-24448162 ATGGGGAAACAGCAGCTGGTGGG + Exonic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1156634435 18:39010717-39010739 ATGTAGAGAGAGAAGCATGCTGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156980837 18:43286458-43286480 GTGGAGCTACAGAGGCAGGCAGG - Intergenic
1156992052 18:43420762-43420784 ATAGAGGAACAGAAGAATGCAGG - Intergenic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158443721 18:57500621-57500643 CTAGAGAAACAGAAGCACGCAGG + Intergenic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158639821 18:59194237-59194259 ATGGAGGAAGTGAAGAAGGCAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158937977 18:62382669-62382691 ATGGCGGCACAGAAGCAAGCTGG - Intronic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160319399 18:77876282-77876304 AAGAAGAAACAGCAGCTGGCTGG + Intergenic
1160694821 19:478373-478395 ATGGGGAAACGGAGGCAGGTGGG - Intergenic
1160788828 19:913403-913425 ACGGGGAAACCGAGGCAGGCGGG + Intergenic
1160788844 19:913452-913474 ACGGGGAAACCGAGGCAGGCGGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161207483 19:3048809-3048831 ATTAAAAAACAAAAGCAGGCCGG - Intergenic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162077745 19:8199746-8199768 ATAGAAAGACAGAACCAGGCTGG + Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1163087805 19:14994823-14994845 AAGAAGAAAAATAAGCAGGCAGG + Intronic
1163396021 19:17061889-17061911 ATGGGGAAAGACTAGCAGGCTGG + Intronic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164419442 19:28075773-28075795 GTGGAGGGACAGAAGCAGTCAGG + Intergenic
1164420561 19:28088177-28088199 GTGGAGCCACAGAAGCAGACAGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164859837 19:31554185-31554207 AAGGAGAAACCGAGGCAGCCAGG - Intergenic
1165159247 19:33806181-33806203 AGGGAGAAACAGAGGCAGACAGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166097601 19:40550813-40550835 ATGCAGAAAAACAAACAGGCCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166684093 19:44784860-44784882 ATCTAGAAACAAAAGCTGGCTGG - Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167924921 19:52813583-52813605 CTGGAGGGACAGGAGCAGGCAGG - Intronic
1168058133 19:53874935-53874957 GTGGAAAAAGAGAAACAGGCTGG - Exonic
1168074968 19:53975998-53976020 GTGGGGAAACTGAAGCAAGCTGG + Intronic
1168329637 19:55559786-55559808 ATAGACAAACAGAAGCTGTCTGG - Intergenic
1168340491 19:55620618-55620640 ATGGGGAAACAGAAGCTTGGAGG + Intergenic
925002653 2:418283-418305 ATGGAGATAAAGAAGCTAGCAGG - Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
926684472 2:15688219-15688241 ATGGGGGAACAGCCGCAGGCAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927284768 2:21345210-21345232 CTGGAGAAAGAGAAGCAGTGTGG - Intergenic
927529565 2:23782111-23782133 ATAAAGAAACAGAAGTTGGCTGG - Intronic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928110678 2:28506412-28506434 TTTGAGGAACAGGAGCAGGCTGG + Intronic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928431654 2:31223821-31223843 ATAAAGAAACAGAAGCGGCCAGG - Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930068465 2:47346001-47346023 AGAGAGGAACAGAAGCAGGTAGG - Intronic
931328156 2:61249783-61249805 TGGTAGAAACAGAAACAGGCTGG - Intronic
931689304 2:64821739-64821761 ATTGAGAAACAGGACTAGGCAGG - Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
931892731 2:66692375-66692397 AAGGACATACAGAAGCGGGCAGG + Intergenic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933836695 2:86251602-86251624 TGGGAGAAACAGAAGAGGGCAGG - Intronic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934505864 2:94893119-94893141 ATAGAGAGACAAATGCAGGCTGG + Intergenic
935083424 2:99821902-99821924 ATGAAGAAACAAAGGCAGCCAGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935400087 2:102651219-102651241 TTTGAAAAACAGAAGCAGGCAGG - Intronic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935786650 2:106555167-106555189 ATGGAGAAACTGAAGCAAAGAGG + Intergenic
936097448 2:109541838-109541860 ATGGAGCAGCCGGAGCAGGCTGG - Intergenic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938700896 2:133878359-133878381 ATGGAGATACAGAACCAGGCAGG + Intergenic
939177772 2:138769592-138769614 AAGGAGAACCACACGCAGGCAGG + Intronic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941862124 2:170293686-170293708 ATAGAGAAAGAGAAGCAGTAGGG + Intronic
941903382 2:170698415-170698437 ATCCAGAAAGAAAAGCAGGCAGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943621899 2:190158071-190158093 ATAGAGAAACAGAACTGGGCAGG - Intronic
944141451 2:196461175-196461197 AGGGAGAAAGAAAGGCAGGCAGG + Intronic
944279935 2:197884446-197884468 ACGTAGCAACAGAAGGAGGCTGG + Intronic
944513227 2:200484839-200484861 ATGGAGAAACTGAAGCACAGAGG - Intergenic
944656697 2:201882793-201882815 AGGAAGAGACAGAAGCAGCCAGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945194910 2:207228672-207228694 ATGGAGTAACTGAAGTAGGGAGG - Intergenic
945195775 2:207236483-207236505 ATGGAGAAAAACAACCAGGAGGG + Intergenic
946178475 2:217936321-217936343 ATGGATGAACTGCAGCAGGCAGG - Intronic
946508367 2:220326137-220326159 AGGAAGAAACAGAGGCAGGGAGG - Intergenic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946954017 2:224908791-224908813 TTGAAAGAACAGAAGCAGGCTGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947362019 2:229355410-229355432 ATGAAGAAACAGAAGCCAGTAGG + Intergenic
947848077 2:233261686-233261708 ATGGAGAAAAGGAACAAGGCTGG - Intronic
948364765 2:237447726-237447748 AGGGAGAAACAGCAGCGGCCTGG + Intergenic
948399192 2:237670762-237670784 ACGCAGAAACTGAGGCAGGCAGG - Intronic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1168902466 20:1376650-1376672 ATGAAGAAACTGAGGCAGACAGG + Intronic
1169252941 20:4074132-4074154 ATGATGAAAAAGAAGCAGGGGGG - Intronic
1169473577 20:5910387-5910409 ATCGGGAAGCAGCAGCAGGCAGG - Intergenic
1170778333 20:19400714-19400736 AGGGAAACACAGAAGCAGACTGG - Intronic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1173148223 20:40543806-40543828 AAGGTGAATCAGATGCAGGCAGG - Intergenic
1173260281 20:41428746-41428768 ATGTAGAAAAAGAAGAGGGCAGG + Intronic
1173468708 20:43305563-43305585 ATGGAGAGAAAGAAGCAGACAGG + Intergenic
1173909735 20:46657780-46657802 AAGGCGAACCAGGAGCAGGCAGG + Intronic
1174161114 20:48551133-48551155 ATGGAGAAACTGAGGCACACAGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175365955 20:58456386-58456408 ATAAAGAAACTGAAGCTGGCAGG + Intergenic
1176231357 20:64034637-64034659 ATGGAGAGACGGAAGCATGAGGG + Intronic
1176652463 21:9563459-9563481 AGGAAGAAACAGACACAGGCAGG + Intergenic
1177911934 21:27043626-27043648 AGGGAGACATAGAAGCAGGTGGG + Intergenic
1178384112 21:32135480-32135502 ATGTAGAAACCGGAGCAAGCTGG - Intergenic
1178414024 21:32389292-32389314 ATGAAGTCAAAGAAGCAGGCAGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178442719 21:32612031-32612053 ATGGAGAAAGAGGGGCAGGGTGG - Intronic
1179342199 21:40523150-40523172 ATAGTGATACAGAAGCGGGCAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181565787 22:23736552-23736574 ATAAAGAAACAGAAGCTGGCCGG + Intergenic
1182024333 22:27105944-27105966 AGGGAGAAACATAAGCATGTAGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182250690 22:28997661-28997683 ATGGAGAAACGGAGGCAGAGAGG - Intronic
1182404760 22:30116853-30116875 ATTGAGAAACATGGGCAGGCAGG + Intronic
1182441982 22:30369993-30370015 ATGGTGACACAAGAGCAGGCAGG + Intronic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182764070 22:32745787-32745809 ATGGAGAAAGAAACGCAGACAGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184210213 22:43030907-43030929 ATGGAGGGAGAGCAGCAGGCGGG - Intergenic
1184513031 22:44944092-44944114 ATGGAGAAACTGAGGCTTGCGGG - Intronic
1184605679 22:45573377-45573399 ATGAAGAAACCCAAGTAGGCCGG + Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185195059 22:49464175-49464197 ATGAATAAACAGTAGAAGGCAGG - Intronic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
1185258295 22:49848645-49848667 ATGGGGAAACAGAGGCACGGTGG + Intergenic
1185408317 22:50670040-50670062 ATTTAGAAAAAGAATCAGGCTGG + Intergenic
949104927 3:192578-192600 AAGGAGAAAAAGAACTAGGCCGG + Intergenic
949279023 3:2324568-2324590 AAAGAGAAACAGAAGCTAGCAGG - Intronic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949823264 3:8138312-8138334 ATAAAGAAACAAAAGGAGGCTGG + Intergenic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950193022 3:10991506-10991528 GTGGGGAAACAGAAGAAGTCAGG + Intergenic
950279943 3:11698201-11698223 ATGAAGAAACAGCTGGAGGCTGG + Intronic
950716515 3:14851319-14851341 ATGAGGAAACTGAGGCAGGCAGG + Intronic
951132514 3:19064628-19064650 ATGGTGAAACTGAAGCATGCAGG + Intergenic
951601242 3:24378112-24378134 AGGCAGAAACTGAATCAGGCAGG + Intronic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954487606 3:50868366-50868388 AAGAAAAAACAAAAGCAGGCCGG - Intronic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
954852937 3:53618582-53618604 ATGGAAAACCAGAAGCGGGTGGG - Intronic
956530254 3:70211248-70211270 ATGGAGAAAGAAAAGCAGAAAGG - Intergenic
956712016 3:72047463-72047485 ATGGAGAAATGGAAAAAGGCAGG - Intergenic
956751980 3:72350857-72350879 ATGCATAAATAGAAGAAGGCAGG - Intergenic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957578514 3:82040017-82040039 TTGTAGAAACAGGAACAGGCTGG - Intergenic
957940565 3:86997554-86997576 ATAAAGAAACAGATGCAGACAGG - Intergenic
958193761 3:90216656-90216678 GTGTAGAAAGAGAAGCAAGCAGG - Intergenic
958259768 3:91367058-91367080 ATAGGGAAACTGAAGCAGGAGGG + Intergenic
958420733 3:93927549-93927571 ATGCAGATACAGAAGCACGTTGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959664524 3:108905885-108905907 ACGTAGAAAAAGAAGCAGGTGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961614681 3:128169468-128169490 ACGGTGAGACAGAAGAAGGCAGG + Intronic
961618949 3:128207993-128208015 AAGGAAAAAAAGAAACAGGCAGG - Intronic
962046207 3:131761802-131761824 ATGTGGAAATAGAAGCAGGTAGG + Intronic
962326896 3:134441877-134441899 AGGGAGAAACAAAAGCTTGCAGG - Intergenic
962627443 3:137239880-137239902 ATGGAGAAAGAGAGGAAGGTGGG + Intergenic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
962937042 3:140090773-140090795 ATCAAGACTCAGAAGCAGGCTGG + Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964225016 3:154388636-154388658 AGGCAGGAACAGAGGCAGGCAGG + Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965259365 3:166460589-166460611 ATGAAGAAACACAAGTAGACAGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
966816981 3:183897330-183897352 ATGGAGCAGCAGATGCTGGCTGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967827652 3:193891288-193891310 ATCAAGAAATTGAAGCAGGCCGG + Intergenic
968469648 4:773557-773579 ATGGAGAGACAGACGCGGGTGGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
970873602 4:20844480-20844502 ACAGAGAGACAGAAGCCGGCAGG + Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
971734249 4:30425661-30425683 AGGGAGAAAGAGATGCAGGGAGG + Intergenic
971819791 4:31537244-31537266 AATGAAAAACAGAAGCAAGCTGG - Intergenic
972320072 4:37965228-37965250 ATGGGGAAACTGAAGCACTCAGG - Intronic
972706687 4:41551593-41551615 ATGAACAAAAGGAAGCAGGCTGG - Intronic
973077542 4:45948127-45948149 ATGGAGGAAGAGAAGCAGTGTGG - Intergenic
973841562 4:54866410-54866432 ATGGAGAAATAGGGGAAGGCAGG - Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
977133092 4:93267443-93267465 ATGGAGAAAGAGGTGCAGCCTGG + Intronic
977447845 4:97154051-97154073 AGGTAGAAACAGAAGCTAGCTGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978627921 4:110708486-110708508 AGGAAGAAACAGAAAAAGGCTGG - Intergenic
979379027 4:119986747-119986769 ATGGCGAAATAGAAGCAAACTGG + Intergenic
979838155 4:125400500-125400522 ATGGAGAAAAATAAGAATGCTGG - Intronic
979853542 4:125603389-125603411 AAGGAGAAAGGGAAGAAGGCAGG + Intergenic
979952361 4:126908869-126908891 ATGGAATCACAAAAGCAGGCAGG - Intergenic
980178854 4:129380023-129380045 ATGGAGAAAGAGAAGCTTCCTGG + Intergenic
980620428 4:135294361-135294383 ATGGAGGCATAGAAGCAAGCTGG - Intergenic
981475372 4:145181390-145181412 TTGGTGCAACAGAAGCATGCTGG - Intergenic
982783177 4:159512203-159512225 ATGGTGGAACAGATGTAGGCTGG + Intergenic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
984032182 4:174617969-174617991 ATTGAGAAAAAGAGTCAGGCTGG + Intergenic
984176034 4:176418164-176418186 ATGCATAAATAGAATCAGGCTGG - Intergenic
984391588 4:179140722-179140744 TTGGAGATATAGAAGCAAGCAGG - Intergenic
984506353 4:180623784-180623806 ATGGAGAAAAATACCCAGGCTGG - Intergenic
984652705 4:182287282-182287304 ATGGAGACAGAGAACCAGGCAGG - Intronic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985484988 5:143470-143492 ATGGAAGTACAGCAGCAGGCGGG - Exonic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
985993920 5:3585799-3585821 ATGGAGTAAAAGCAGCACGCTGG + Intergenic
987384709 5:17318360-17318382 ATTAAGAACCAGAAGAAGGCTGG + Intergenic
989358528 5:40572498-40572520 AAGCAGAAACAGCAGCAGACCGG + Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990050490 5:51494189-51494211 CTTGAGAAACACAAGAAGGCTGG - Intergenic
990169920 5:53036641-53036663 TGGGAGAAAAATAAGCAGGCTGG - Intronic
990458360 5:56010616-56010638 ATGGAGACACAGAGGCTTGCGGG + Intergenic
991087125 5:62657925-62657947 ATGGAAAAACAAAAAAAGGCAGG + Intergenic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993054558 5:82967536-82967558 ATGGAGGCACAGAAGCAAGCTGG + Intergenic
993342688 5:86743540-86743562 ATGGAGAAATGGAGGCATGCAGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
994853587 5:105088263-105088285 AAGGAGAAACGGCAGCAGACAGG - Intergenic
995032231 5:107493936-107493958 AGGCTGAAACGGAAGCAGGCTGG + Intronic
995203095 5:109447975-109447997 ATGGAAAAACAGATCCATGCTGG + Intergenic
995217750 5:109614610-109614632 TTGGAGAAAAGGAAGCTGGCAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995836839 5:116407770-116407792 ATTGGGAAACTGAGGCAGGCGGG - Intronic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
997475571 5:134140530-134140552 TCAAAGAAACAGAAGCAGGCTGG + Intronic
997595738 5:135106185-135106207 AAGGAGAAACAGAATCAGTCGGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
998477903 5:142436812-142436834 ATGGAGAAAGGGATGGAGGCTGG - Intergenic
998564885 5:143208015-143208037 ACACAGAGACAGAAGCAGGCTGG - Intronic
998883298 5:146667485-146667507 ATGGAGAAAAAGAAGAAAGCAGG + Intronic
999020653 5:148162242-148162264 ATAGAGACACAGAAACAGACAGG + Intergenic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999778630 5:154830928-154830950 ATTGGGAAACAGAAACAGTCAGG + Intronic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
1000604452 5:163313268-163313290 ATAGAGAAACAGAACAGGGCAGG + Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000670810 5:164060857-164060879 ATAGAGAACCAGAAGCAGATGGG - Intergenic
1000738962 5:164940610-164940632 ACTGAGAAACAGAATCATGCTGG - Intergenic
1001141141 5:169144950-169144972 ATGGTTAAACATAATCAGGCTGG - Intronic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001876432 5:175205887-175205909 ATGGAGAAAGAAAACCAAGCAGG + Intergenic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1002809681 6:615539-615561 ATGAAAAACCAGAAACAGGCTGG + Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003445093 6:6176958-6176980 ACCGCCAAACAGAAGCAGGCTGG + Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003797074 6:9616398-9616420 AGGGAGAAAAAGAAGGAAGCAGG + Intronic
1004524602 6:16394899-16394921 AAGGAGAAACAGTAGCATGTTGG + Intronic
1005103853 6:22202218-22202240 ATGGTGAAACTCCAGCAGGCAGG - Intergenic
1005143454 6:22661141-22661163 ATGAAGAAACTGAAGCAGAGAGG - Intergenic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006495215 6:34417992-34418014 ATGGAGAAACTGAGGCAGAGGGG + Intronic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007040744 6:38719874-38719896 ATGGTGGCACAGAAGCAAGCTGG + Intronic
1007237079 6:40398323-40398345 GTTGAGAAACAGAAGCTGCCAGG + Intronic
1007605416 6:43114427-43114449 AGGGAGAAACAGAGGGAGACAGG - Intronic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008366087 6:50682293-50682315 AAGGAGGAAGAGAAGCAGGGAGG - Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009443192 6:63707258-63707280 ATGGGGAAACATAAGCAGTGGGG - Intronic
1009925931 6:70120712-70120734 ATGGATACTTAGAAGCAGGCTGG - Intronic
1010065630 6:71679629-71679651 ATCTACAAAAAGAAGCAGGCCGG - Intergenic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010725306 6:79326221-79326243 ATGGACAAACAGATCCATGCTGG + Intergenic
1010837434 6:80607501-80607523 ATGGAGAAACTGAAAAAGCCTGG + Intergenic
1011580967 6:88864235-88864257 ATGGTGAAAGAGAAGCATACAGG + Intronic
1012289078 6:97428715-97428737 ATGTAGGAATAAAAGCAGGCTGG + Intergenic
1012308963 6:97697038-97697060 ATAGAGAATCAAAAGCCGGCAGG - Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012498521 6:99862419-99862441 ATGGAGAAATTGAAGAGGGCTGG + Intergenic
1012669493 6:102024232-102024254 AAAGAGAAACAGAGGTAGGCTGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1014826725 6:126055367-126055389 ATAGTGAAGGAGAAGCAGGCAGG - Intergenic
1015129354 6:129792543-129792565 TTGGAGAACCAGAAGCAGTTTGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015986432 6:138888608-138888630 ATTAAGAAAAAGAAGTAGGCTGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1019540346 7:1548407-1548429 CTGGAGAAACTGAAGCACGTGGG + Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020070556 7:5224125-5224147 ACAGTGAAACAGAATCAGGCTGG - Intronic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021706122 7:23369536-23369558 ATGGACAAACAGAACCAGTTTGG + Intronic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1023466756 7:40464448-40464470 AGGGACAAACAGAATTAGGCAGG + Intronic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1025796543 7:64742982-64743004 TTTGGGAGACAGAAGCAGGCGGG + Intergenic
1025940346 7:66072331-66072353 ATAAAGAAAGAGAAGCTGGCTGG - Intergenic
1026181997 7:68049735-68049757 ATGGTGAAACAGAATCATGTTGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026225769 7:68439186-68439208 ATGGAGATAGAGTAGCAGGATGG + Intergenic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1029138760 7:98394713-98394735 ATAGAGACACAGGAGCAGACTGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030035505 7:105405223-105405245 ATGGAGAAAAAGTAGCAGCTTGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032158195 7:129487948-129487970 ATGGAGAAACTGAAGCACTAAGG + Exonic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033758635 7:144418263-144418285 ATGGAGGGAGAGATGCAGGCGGG - Intergenic
1033848236 7:145461908-145461930 ATGAAGTAAAGGAAGCAGGCAGG - Intergenic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034411790 7:150945923-150945945 ACCTAGAAACAGAGGCAGGCTGG + Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034882766 7:154775218-154775240 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035582708 8:749919-749941 GTGGAGACAGAGAAGCAGGCTGG - Intergenic
1036147251 8:6265495-6265517 ATGGTGACAGAGGAGCAGGCAGG + Intergenic
1036387171 8:8292552-8292574 AAGGGGAAAGAGGAGCAGGCCGG - Intergenic
1037282828 8:17262285-17262307 ATGGTGTCACAGAAGCAAGCTGG - Intronic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037747116 8:21654565-21654587 AAGGAGAAACAGAGACTGGCTGG - Intergenic
1038059243 8:23893855-23893877 ATGGAGAAATGCAAGCAGCCAGG + Intergenic
1038134068 8:24766884-24766906 ATGAAGACACAGGAGCAAGCTGG + Intergenic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039341146 8:36651617-36651639 AGGAAGAAAATGAAGCAGGCTGG + Intergenic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1041347313 8:56912955-56912977 CTGAAGAAAATGAAGCAGGCAGG - Intergenic
1041516464 8:58704492-58704514 AAGGAGAAAGAGAAGAAAGCAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041565843 8:59277831-59277853 ATGGAGTATGGGAAGCAGGCAGG + Intergenic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1041868174 8:62600622-62600644 ATAGAGAAACAAATGCAGGTGGG - Intronic
1042049663 8:64689862-64689884 AATTAGAAACAGAAGCAGGCCGG - Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1043419642 8:80085544-80085566 ATGGTGATACAGCAGCTGGCTGG + Intronic
1044274035 8:90279502-90279524 ATGTAGAAAGAGAGACAGGCAGG - Intergenic
1044386508 8:91595246-91595268 AGGGAGAAACAAAAGCAGCAGGG + Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045776625 8:105811000-105811022 ATGAAAAATCAGACGCAGGCTGG + Intergenic
1045783526 8:105896246-105896268 TTTGAGAAACAGCAGCAGTCAGG - Intergenic
1045995237 8:108354218-108354240 ATGGAGATAGAGTAGAAGGCTGG + Intronic
1046198968 8:110897102-110897124 ATAGAGACTCAGTAGCAGGCAGG + Intergenic
1046358631 8:113121149-113121171 CTGGAGATAAAGAAGCATGCAGG + Intronic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047215867 8:122875700-122875722 ATGTGGAAACAGAAGCTGCCTGG + Intronic
1047369996 8:124248106-124248128 AGGGAGAAAGGGAAGCAGGCCGG + Intergenic
1047412035 8:124631689-124631711 TTGGAGAGACAGAAGCTGGCAGG - Intronic
1047441110 8:124879482-124879504 ATTGAAAAACAGACGTAGGCAGG + Intergenic
1048044430 8:130759698-130759720 ATGGAGTATAAAAAGCAGGCAGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1048968775 8:139632432-139632454 AGGAAGCAACAGAAGCAGGTGGG + Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049212003 8:141391286-141391308 AGGGGGAAACAGAGGCAAGCTGG - Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050720798 9:8586849-8586871 ATAAAGAAACTGAAGCCGGCTGG + Intronic
1050785643 9:9398106-9398128 AGGGAGAAAGAGAAGCAGGGAGG - Intronic
1050856573 9:10364526-10364548 ATGCATAAAGAGAAGCAGCCTGG - Intronic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1052593300 9:30526988-30527010 ATGCTGAAAAAGAAACAGGCAGG + Intergenic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1054889045 9:70232355-70232377 TTGGGGGAACAGAAGCAGGGTGG + Intergenic
1055820170 9:80252857-80252879 ACTGAGAAACTGAAGCTGGCAGG + Intergenic
1056212158 9:84374819-84374841 ATCGAGAATTAGAAGAAGGCTGG + Intergenic
1056531827 9:87495159-87495181 AGAGAGAAAGAGAAGCAAGCAGG + Intergenic
1056824951 9:89870584-89870606 CTGGAGAAAAGGAATCAGGCTGG - Intergenic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057497721 9:95574134-95574156 ACAGAGAAAGAGAAGCAGGAAGG - Intergenic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1059132900 9:111773187-111773209 ATGGTGGCACAGAAGCAAGCTGG - Intronic
1059346640 9:113633445-113633467 ATAAAGAATCAGAAGCTGGCCGG + Intergenic
1060244004 9:121928733-121928755 ATTGAAAAAAAGAAACAGGCCGG - Intronic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060446494 9:123693425-123693447 AAGGAGCAACACAAGCAGGCTGG - Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060948980 9:127588638-127588660 ATGAAAAAACCAAAGCAGGCCGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1062226843 9:135457210-135457232 ATGGAGAAACAGAGGCACAGGGG - Intergenic
1062376591 9:136264522-136264544 ACGGAGAAACAGGAAAAGGCAGG - Intergenic
1062419172 9:136471168-136471190 AAGGAGAAACATAGGCTGGCCGG + Intronic
1202630204 M:10194-10216 ATGGAGAAAGGGACGCGGGCGGG - Intergenic
1185505238 X:628362-628384 ATGGAGAGAGAGAAACAGACAGG - Intronic
1185505251 X:628512-628534 ATGGAGAGAGAGAAACAGACAGG - Intronic
1185505262 X:628660-628682 ATGGAGAGAGAGAAACAGACAGG - Intronic
1185505299 X:629142-629164 ATGGAGAGAGAGAAACAGACAGG - Intronic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185660532 X:1725134-1725156 AGAGAGAAAGAGAGGCAGGCAGG - Intergenic
1185766964 X:2733140-2733162 AGGGAGAGACAGAGGAAGGCAGG - Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186145590 X:6621193-6621215 TTACAAAAACAGAAGCAGGCTGG - Intergenic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1187069122 X:15870467-15870489 ATGGAGAACAAGAAGCTGGGAGG + Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187996950 X:24936825-24936847 ATGGAATAACACAACCAGGCCGG - Intronic
1188604585 X:32012462-32012484 TTGAAGAAACAGTAGCAGCCGGG - Intronic
1188908754 X:35820268-35820290 ATGTACAAACTGAAGCAGTCAGG + Intergenic
1189546488 X:42047482-42047504 ATAGAGAAATGGAAGCAGTCGGG - Intergenic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189769481 X:44409549-44409571 ATGGCAAAACAGAAGCTGGTAGG - Intergenic
1190936639 X:55003900-55003922 CTGGACAAACAGAATCAGTCAGG - Intronic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1193667419 X:84338918-84338940 AAGGTGAAAGGGAAGCAGGCAGG - Intronic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1195575429 X:106444370-106444392 AAGGAGAAATACATGCAGGCAGG + Intergenic
1195690128 X:107617442-107617464 CTAGAGAAAGAGAACCAGGCTGG + Intergenic
1195921411 X:109987559-109987581 ATGGAGAAATGGAAGGAGACAGG + Intergenic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196252094 X:113473162-113473184 AGAGAGAAACAGAAGAGGGCAGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196769693 X:119281438-119281460 ATGGAGAATCAGAGGCACCCAGG - Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197306742 X:124851706-124851728 ATGGAGAAATGGAAGCAATCAGG - Intronic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197741371 X:129897081-129897103 AAGGAGAAACAAAAGCCGGCCGG + Intergenic
1197823573 X:130565558-130565580 ATGAAGATAGAGAAGCAGGGAGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198251890 X:134887124-134887146 ATAAAGAAACAGAAGTAGCCTGG + Intergenic
1198485725 X:137085672-137085694 CTGGAGAAACACTAGCAGGTAGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199902211 X:152186889-152186911 TTGAAGAAAAGGAAGCAGGCTGG - Intronic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200916041 Y:8572090-8572112 ATGGAGAGACAGTAGGAGTCCGG + Intergenic
1200958460 Y:8973633-8973655 GGGGAGAAACAGAGCCAGGCGGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201372676 Y:13282526-13282548 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201373357 Y:13289470-13289492 AGAGAGAAACAGAACAAGGCAGG - Intronic