ID: 1148547418

View in Genome Browser
Species Human (GRCh38)
Location 17:48528795-48528817
Sequence GCCCCCAGCAAGCCACAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148547418_1148547422 8 Left 1148547418 17:48528795-48528817 CCTGGTTGTGGCTTGCTGGGGGC 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1148547422 17:48528826-48528848 CACGGCGTTCCAGAAGTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1148547418_1148547420 -10 Left 1148547418 17:48528795-48528817 CCTGGTTGTGGCTTGCTGGGGGC 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1148547420 17:48528808-48528830 TGCTGGGGGCAGGCCTTGCACGG 0: 1
1: 0
2: 4
3: 44
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148547418 Original CRISPR GCCCCCAGCAAGCCACAACC AGG (reversed) Exonic
900079562 1:845400-845422 GCAGCCTGCAAGCCCCAACCTGG - Intergenic
901018875 1:6245996-6246018 GCCCCCAGCCTCCCCCAACCCGG + Intergenic
902197799 1:14810696-14810718 GTCCCCAACAAGCCACACCCTGG - Intronic
902472473 1:16658361-16658383 GCCCCCGGCCCGCGACAACCCGG + Intergenic
902486331 1:16749085-16749107 GCCCCCGGCCCGCGACAACCCGG - Intronic
902699243 1:18160460-18160482 GTCACCAGGAAGCCACACCCAGG - Intronic
903577527 1:24347931-24347953 GCCCCCAGCCAACCACAAGCAGG - Intronic
904094019 1:27963719-27963741 CCCCCCACCAAGCCACGACAGGG - Intronic
907456826 1:54581551-54581573 GGCCCCAGCTAGCCACACCATGG - Intronic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
915355213 1:155251704-155251726 TCCCCCAGCAAGACCCCACCAGG + Intronic
920518000 1:206600783-206600805 GGGCCCAGCAAGCCGCATCCTGG + Intronic
921050503 1:211507969-211507991 GCCTCCAGCCAGCAAGAACCAGG + Intergenic
922432533 1:225570208-225570230 GCCCCCATCAAGGCCCAGCCAGG + Intronic
922570322 1:226630944-226630966 GCCCCCAGCAATCCAGAGCTAGG + Intergenic
922617713 1:226972963-226972985 GGCCACAGCAAGCCACAGCCAGG - Intronic
923084696 1:230694607-230694629 GCCCCCAGCCTGCCACAAAGAGG + Intergenic
1065343126 10:24724137-24724159 CCCCCCAGCACCCCAAAACCAGG + Intergenic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1067570615 10:47368573-47368595 GCCCCAGGCAAGCCCCGACCTGG - Exonic
1069916767 10:71791350-71791372 GGCCCCAGCACCCCACAACCAGG + Intronic
1072213228 10:93266056-93266078 GCCCTCTGCAAGCCACAAAGAGG + Intergenic
1076264286 10:129097590-129097612 GCCCGCAATAAGCCACAGCCAGG - Intergenic
1076842969 10:133055674-133055696 GCCCTCAGGAAGCCACATCGTGG - Intergenic
1077112004 11:866084-866106 GCCCCCAGGAACCCACGATCGGG + Intronic
1077869980 11:6253592-6253614 TCCCCCTGCAAGCCACACACAGG - Intergenic
1078875732 11:15394249-15394271 GCCCCCTGCATTCCACAAGCAGG - Intergenic
1081854983 11:46297209-46297231 CCACCCAGCCAGCCACAGCCAGG - Intronic
1081905928 11:46670046-46670068 GCCCCGCACAAGCCACAAACTGG + Intronic
1081971027 11:47198831-47198853 GTTCCCAGCCAGCCACCACCAGG - Intergenic
1086154081 11:83646713-83646735 GCCCCGAGGAAGTCAGAACCTGG - Intronic
1091223897 11:133946455-133946477 GCCCCCAGGCATCCACAACTTGG + Intronic
1092540874 12:9419162-9419184 GCCCCCGGCCAGGCACACCCAGG - Intergenic
1095964650 12:47858653-47858675 GCACTCAGCAAGCCACAGCCAGG - Intronic
1102019750 12:109674003-109674025 GCCCCCAGCAGGGCCCAGCCTGG - Intergenic
1102462109 12:113106255-113106277 GACCCCACCATGCCACAGCCAGG + Intronic
1103721323 12:122977024-122977046 GACCCCAGCATCCCACACCCAGG - Intronic
1103971868 12:124677622-124677644 GCCCCCTGTAAGTCAGAACCAGG + Intergenic
1111826718 13:93276695-93276717 GCCAGCAGCAAGCCACTGCCTGG - Intronic
1113857491 13:113455709-113455731 GCCCCCAGCTAGCAACCAGCGGG - Intergenic
1114598225 14:23932662-23932684 GCCCCAAGAAGGCCACACCCAGG + Intergenic
1118374721 14:65166921-65166943 GCTCCAAGAAAGCCACAGCCAGG + Intergenic
1118637618 14:67762362-67762384 GCCCCAAGCATGCCACGCCCCGG + Exonic
1121734108 14:96205969-96205991 GCCCCCATCACCCCACACCCAGG - Intronic
1122120777 14:99552350-99552372 GACCCCAGCAAGGCAGGACCAGG + Intronic
1124453595 15:29821704-29821726 GCCCTCAGCGAGCCGCAGCCAGG + Intronic
1124625275 15:31304181-31304203 CCCCCCAGCCAGGCACAGCCTGG + Intergenic
1124720435 15:32106955-32106977 GCCCTAAGCAAGCCACTAGCCGG - Intronic
1127828527 15:62728050-62728072 GCACCCAAGAAGCCACTACCAGG + Intronic
1128115503 15:65102413-65102435 GCCCCCAGCAGCCTCCAACCGGG - Exonic
1128742427 15:70093211-70093233 TCCCTCAGGAAGCCACAAGCTGG + Intronic
1131065989 15:89435485-89435507 GGCCCCAGCCACCCACAGCCTGG - Intergenic
1136411242 16:30078564-30078586 GTCCCCAGGAGGCCATAACCAGG - Intronic
1140247287 16:73262959-73262981 GCCCCAACCAAGCCACCAGCAGG + Intergenic
1141172597 16:81700739-81700761 GCCTCCAGCAAGCCTCCGCCCGG - Intronic
1142059900 16:88022582-88022604 GCACCCTGCAAGACACAACGGGG - Intronic
1142806153 17:2372271-2372293 GCCCCCAGCCCGCCACAGCCCGG - Intronic
1142852577 17:2711437-2711459 GGCCCCAGCGAGATACAACCGGG + Intronic
1142873384 17:2835988-2836010 GCCCCCAGCCAGCCACTGGCGGG + Intronic
1143579915 17:7819419-7819441 GCCCCCAACATGCCCCAGCCCGG + Intronic
1144303334 17:13944229-13944251 GTCCTCAGCAATCCAAAACCGGG - Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1144945816 17:18968988-18969010 GGCTCCAGCAAGCCACTCCCTGG - Exonic
1146940674 17:36842400-36842422 GCCCCCTTCCAGCCCCAACCAGG + Intergenic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1148906807 17:50917484-50917506 GCCCACAGCAGGCCACAGCTGGG + Intergenic
1148957677 17:51366993-51367015 GGCACCGGCCAGCCACAACCTGG + Intergenic
1150657827 17:67051863-67051885 GCCCCCAGCAAGGCACTCCATGG + Intronic
1150703481 17:67467700-67467722 GCCACCTGCCAGCCACAACCAGG + Intronic
1150816575 17:68396698-68396720 TCCCCCAGCAAACCAGAACATGG + Intronic
1151963318 17:77418878-77418900 GGCCCCTGGAAGCCACAGCCAGG + Intronic
1152244108 17:79176375-79176397 GCCCCCAGCACCCCCCAAGCAGG + Intronic
1152570365 17:81118980-81119002 GCCCCCAGCAGGGCTCCACCTGG + Intronic
1157621631 18:49020496-49020518 AACCACAGCAAGCCACCACCAGG - Intergenic
1160527743 18:79547459-79547481 GCCCCACGCAGGCCACAGCCGGG + Intergenic
1160570127 18:79810345-79810367 GCCCCCAGCAAACCCCCTCCGGG - Intergenic
1160685831 19:436277-436299 GCCCGCAGCCTGCCACATCCTGG - Exonic
1160810978 19:1012806-1012828 GCACCCAGCCAGCCCCAGCCAGG - Intronic
1161162253 19:2767978-2768000 GCCCCCACCACGCCGCAGCCGGG - Intronic
1161723560 19:5916303-5916325 GCCCCCAGCAAGCCTGAGCCCGG - Exonic
1162299265 19:9835112-9835134 GCCCCCGGCCAGCCTCAGCCTGG - Intergenic
1162720185 19:12657454-12657476 GCCCCCAGCCTGCCGCAAGCTGG + Exonic
1165095557 19:33407930-33407952 ACCCCCAGCCAGCCACCCCCGGG - Intronic
1166738133 19:45098091-45098113 CTCCTCAGCAAGCCACAGCCAGG + Intronic
1167971473 19:53190208-53190230 GCCCACAGCCAGCAACAGCCCGG + Intronic
1168353054 19:55687401-55687423 GCACCCAGCCAGCAACACCCGGG - Intronic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1202704864 1_KI270713v1_random:15166-15188 GCCCCCGGCCCGCGACAACCCGG + Intergenic
926092064 2:10057761-10057783 TCCCCCAGCAGGCCACACCTGGG + Exonic
926712822 2:15896307-15896329 GTGCCCAGCAAGCCCCAAGCAGG + Intergenic
926754669 2:16225399-16225421 GTTACCAGCAAGCCACAGCCTGG + Intergenic
929594599 2:43168359-43168381 GCCCCCAGAAAGTCCCACCCAGG - Intergenic
931488296 2:62716181-62716203 CCCCCCACCACGCCCCAACCCGG + Intronic
932447719 2:71790977-71790999 GCCCCCCGCAGCCCACATCCTGG - Intergenic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
935292435 2:101621675-101621697 GCCCACAGCCAGCCACACCGGGG - Intergenic
936155078 2:110042015-110042037 GCCCCAGGAAAGCCACACCCGGG - Intergenic
936189604 2:110329399-110329421 GCCCCAGGAAAGCCACACCCGGG + Intergenic
936287824 2:111194653-111194675 GTCCCCAGAAAGCCACATCTAGG + Intergenic
937334831 2:121055715-121055737 GGCCCCAGGAAGCCACGGCCAGG - Intergenic
941776174 2:169395996-169396018 TCCCCCAGCACTCCACACCCAGG + Intergenic
944460575 2:199945349-199945371 GCACCCACCAATCCATAACCTGG - Intronic
945834557 2:214823168-214823190 GGACCCAGCAATCCAGAACCTGG + Intergenic
946408793 2:219506418-219506440 GCCCCCAGGAAGCCATACCCAGG - Exonic
947819246 2:233059213-233059235 GCCCCCACCATCCCACATCCAGG - Intergenic
1169065136 20:2690883-2690905 GCCCCCAGCAAGCCACTCCTGGG - Intergenic
1169073581 20:2748772-2748794 ACCCCCAGCAGGCACCAACCAGG - Intronic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1174837403 20:53870752-53870774 GCCCTCAGCGAGTCACAGCCTGG - Intergenic
1176139166 20:63537600-63537622 ACCCCCAAGAAGCCCCAACCGGG - Intergenic
1178550783 21:33537343-33537365 GGACCCAACAAGCCACAAACTGG - Intronic
1179625101 21:42644847-42644869 GCCCCCAGCTCGCCCCAGCCTGG + Intergenic
1181568398 22:23753098-23753120 GCCCCCAGCACGTCACCATCAGG - Exonic
1182696940 22:32204333-32204355 GCCCCCAGCAAGCCACCCCGCGG + Intergenic
1183732717 22:39627749-39627771 GCCCCCACCAGGCCACACCTTGG + Intronic
1184233029 22:43168705-43168727 TCCGCCAGCCAGCCACAGCCTGG - Intronic
1184557099 22:45239575-45239597 CCCCTCAGCAGGCCACACCCTGG - Intronic
1185130410 22:49035593-49035615 CTCCCCAGCAAGCCTCACCCAGG - Intergenic
950437144 3:12986825-12986847 GCCCACAGCAAGCCCCTGCCGGG - Intronic
950572686 3:13811773-13811795 GCCCCCAGCAATGCACACACTGG + Intergenic
950613492 3:14140831-14140853 ACACCCTGCAAGCCACTACCTGG - Intronic
950728263 3:14933768-14933790 CACACCAGCAAGCCACAGCCAGG - Exonic
954428153 3:50454417-50454439 CCCCCCAGCCACCCCCAACCTGG + Intronic
959908803 3:111739721-111739743 GCACCCAGTTAGCAACAACCTGG - Intronic
961637517 3:128342621-128342643 CCGCCCAGCAAGGCACAGCCAGG - Intronic
961659234 3:128459582-128459604 GAACCCAGGGAGCCACAACCTGG + Intergenic
961803303 3:129469360-129469382 GTCCCCAGTCAGCCACAGCCAGG - Exonic
966735033 3:183181245-183181267 GCCCCCAACAAGCCACGTTCTGG + Intronic
967776658 3:193392600-193392622 GCCCCCAGCAAGCCTGACCATGG - Intergenic
968630741 4:1649724-1649746 GCCTCCAGGTAACCACAACCTGG + Intronic
968862092 4:3180756-3180778 GGCCCCAGAAAGCCCAAACCTGG - Intronic
969250469 4:5964910-5964932 ACACCCAGAAAGCCACCACCAGG - Intronic
979787993 4:124740711-124740733 GCCCCTGGCATGCCACACCCTGG - Intergenic
983733089 4:171022423-171022445 CCCCCCAGCACCCCACAAACAGG - Intergenic
992124437 5:73626221-73626243 GCCCCCAGCCAGCCGCCGCCCGG - Exonic
993452969 5:88095284-88095306 GCCCTCAGTAAGTCACAACGAGG - Intergenic
1001334872 5:170788754-170788776 ACCCACAGCAAGGCAAAACCCGG + Intronic
1010454093 6:76035117-76035139 GCCCCTAGCACTCCACAAACTGG - Intronic
1014313116 6:119830252-119830274 GCTCTCAGGAAGCCACATCCTGG - Intergenic
1019520281 7:1457826-1457848 GCCACCAGCCAGCCTCATCCAGG + Intronic
1019595885 7:1858231-1858253 GTCCCCTGCTCGCCACAACCAGG + Intronic
1019774279 7:2903189-2903211 GCCCCCAGCCAGCCACTGCCTGG + Intergenic
1019929539 7:4214651-4214673 GCCCCCAGCAAGCCCAAACGTGG - Intronic
1022101528 7:27172299-27172321 GCTCTCAGCAAGCCAAAAACGGG - Intronic
1024787076 7:52920700-52920722 GCACCGAGCCAGCCACAGCCAGG + Intergenic
1028368210 7:90059738-90059760 GACCCCAGAAATCCACTACCTGG - Intergenic
1033725975 7:144118942-144118964 ACACCCAGGAAGCCACAGCCAGG + Intergenic
1033726984 7:144129538-144129560 ACACCCAGGAAGCCACAGCCAGG - Exonic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1035525942 8:313519-313541 GCAGCCTGCAAGCCCCAACCCGG + Intergenic
1035962404 8:4151976-4151998 CCCCCTAGCAAACCACAAGCAGG - Intronic
1038717995 8:30009130-30009152 CCCATCAGCAAGCCACAGCCCGG + Intergenic
1042639767 8:70920984-70921006 GCTCACAGCAACCCACAATCTGG - Intergenic
1043745535 8:83869497-83869519 GACACCAGCAAGCCAGCACCAGG - Intergenic
1044398489 8:91742467-91742489 GCGCCAAGCAAGTAACAACCTGG + Intergenic
1044866320 8:96574516-96574538 TTCCCCACCAAGCAACAACCAGG + Intronic
1047450638 8:124962384-124962406 GCCCCCACCAACCCCCAGCCAGG + Intergenic
1048167502 8:132076474-132076496 GCCCCCAGATATCCACAAACAGG - Exonic
1049150734 8:141033999-141034021 GCCTCCAGCAAGCTCCAAGCTGG - Intergenic
1049796861 8:144500981-144501003 GCCCCCAGCAGGCCCCGCCCCGG + Intronic
1050641949 9:7677849-7677871 GCCCTCAGCAAGCAAAGACCAGG + Intergenic
1056462045 9:86818023-86818045 GCCACCAGGAAGACACCACCGGG + Intergenic
1056542023 9:87579977-87579999 GTCCCCACCAAGCCACCACTTGG - Intronic
1057167455 9:92940336-92940358 GCCCCAACCAAGCCCCAACCAGG + Intergenic
1057617536 9:96605364-96605386 CTCCCCAGCAAGACACAAGCAGG + Intronic
1057857120 9:98610183-98610205 GCCACCAGGAAGCCACCAACTGG - Intronic
1060482880 9:124028095-124028117 GCCCCCAGCAAATCCCCACCTGG - Intronic
1061759812 9:132842841-132842863 GCCCCTAGCAAGCGAGAAACCGG - Intronic
1061777580 9:132975911-132975933 GTCCCCAGCCAGCCTCACCCAGG - Intronic
1062616210 9:137397148-137397170 GACCCCATCAACACACAACCAGG + Intronic
1062647597 9:137556846-137556868 GCCCTCAGAGAGCCACAGCCTGG + Intronic
1062679506 9:137770824-137770846 TCCCCCAGCAGGACACAGCCTGG - Intronic
1190337360 X:49270324-49270346 GCCCCCAGGCACCCACACCCCGG - Exonic
1196751618 X:119122849-119122871 GCCCCCAGGAAGCCACAAGGAGG + Intronic
1198026293 X:132710949-132710971 GCCCTCAGCAAGCCACATCCTGG + Intronic
1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG + Intergenic
1199213759 X:145244167-145244189 GCTCACAGGAAGCCACAGCCAGG - Intergenic
1200236363 X:154469612-154469634 GCCCCCACCCACCCACACCCAGG - Intronic