ID: 1148547569

View in Genome Browser
Species Human (GRCh38)
Location 17:48529516-48529538
Sequence TAGCCACCAATGGGGCTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148547569_1148547575 -7 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547575 17:48529532-48529554 GTGGCTAGGTTCAGTTCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1148547569_1148547577 6 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547577 17:48529545-48529567 GTTCAGGAGGTGACAGAGCTGGG 0: 1
1: 0
2: 3
3: 31
4: 298
1148547569_1148547580 19 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547580 17:48529558-48529580 CAGAGCTGGGTGAGGCTTCCGGG 0: 1
1: 0
2: 6
3: 56
4: 362
1148547569_1148547581 20 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547581 17:48529559-48529581 AGAGCTGGGTGAGGCTTCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 214
1148547569_1148547578 11 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547578 17:48529550-48529572 GGAGGTGACAGAGCTGGGTGAGG 0: 1
1: 1
2: 5
3: 99
4: 946
1148547569_1148547582 23 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547582 17:48529562-48529584 GCTGGGTGAGGCTTCCGGGGAGG 0: 1
1: 0
2: 4
3: 16
4: 271
1148547569_1148547576 5 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547576 17:48529544-48529566 AGTTCAGGAGGTGACAGAGCTGG 0: 1
1: 0
2: 3
3: 35
4: 316
1148547569_1148547574 -10 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547574 17:48529529-48529551 TTGGTGGCTAGGTTCAGTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 98
1148547569_1148547579 18 Left 1148547569 17:48529516-48529538 CCTGGAAGCCCCATTGGTGGCTA 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1148547579 17:48529557-48529579 ACAGAGCTGGGTGAGGCTTCCGG 0: 1
1: 0
2: 2
3: 38
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148547569 Original CRISPR TAGCCACCAATGGGGCTTCC AGG (reversed) Exonic
901685219 1:10940069-10940091 GAGGCAGCAATGTGGCTTCCAGG - Intergenic
902287277 1:15414657-15414679 TAACCACCAGCGGAGCTTCCAGG + Intronic
904266026 1:29319021-29319043 TAACCACCCAGGGGGCTTCCGGG + Intronic
919397584 1:197069835-197069857 TAGCCACCAGAAGGGCTACCAGG - Intergenic
922697767 1:227740193-227740215 GAGCCACCAATGAGACTCCCTGG + Intronic
1063974874 10:11406999-11407021 TAGCCATCACTGGGGTTTGCAGG + Intergenic
1064089436 10:12371232-12371254 TAGTCATGAATGGAGCTTCCGGG - Intronic
1070009986 10:72463855-72463877 TAACCATGAATGGGGCTTGCAGG - Intronic
1070170874 10:73931983-73932005 TAGCCACACCAGGGGCTTCCTGG - Intergenic
1072976537 10:100063630-100063652 GCATCACCAATGGGGCTTCCTGG - Exonic
1073287026 10:102395518-102395540 TAACCCCCACCGGGGCTTCCCGG + Intronic
1074391364 10:113060890-113060912 TAGCCACCCATGTGGAGTCCTGG + Intronic
1079415841 11:20235667-20235689 TAGCCACCCAGTGGGCTTGCTGG - Intergenic
1081093087 11:38897316-38897338 TACCAACCATTGGTGCTTCCAGG - Intergenic
1083281112 11:61627851-61627873 TTGCCACCAGTGGGACTTGCAGG + Intergenic
1083796826 11:65021744-65021766 CAGCCACCACTGGTGCATCCAGG + Exonic
1085085292 11:73662605-73662627 CAGGCACAGATGGGGCTTCCTGG - Exonic
1087358560 11:97126702-97126724 TATCCACCAATTGTGCTTCTAGG - Intergenic
1090902534 11:131045708-131045730 TACCCACGACTGGAGCTTCCAGG + Intergenic
1093644265 12:21565762-21565784 TAGTGACCAATGTTGCTTCCAGG - Intronic
1096111660 12:49032409-49032431 CAGCCACCTCTGAGGCTTCCAGG - Exonic
1096111895 12:49033759-49033781 CAGCCACCACAGGGGCCTCCGGG - Exonic
1098909265 12:76192599-76192621 TAGTCACCAATGGAGCTTGCAGG + Intergenic
1099546077 12:83981463-83981485 TAGCCACTAATTGAGCTTGCAGG + Intergenic
1104889339 12:132132800-132132822 TGGCCGGCAATGGGGCTGCCAGG + Intergenic
1106079155 13:26486135-26486157 AAGCCAGCAGTGGGGGTTCCTGG - Intergenic
1113964590 13:114145518-114145540 TGGGGACCAATGGGGCTTCTTGG + Intergenic
1114836126 14:26204831-26204853 GACCCACCAATGCGGCTTCAGGG - Intergenic
1118856081 14:69624078-69624100 TTACCACGAATGGGGCTTGCAGG - Intronic
1121580310 14:95025149-95025171 AGCCCACCAGTGGGGCTTCCTGG + Intergenic
1122340501 14:101025251-101025273 CAGCCAGCCCTGGGGCTTCCCGG + Intergenic
1125523314 15:40360044-40360066 TTGCCCCTTATGGGGCTTCCAGG + Intronic
1130902904 15:88220390-88220412 CAGCCCCCAATGGGGCCTGCTGG + Intronic
1132175262 15:99709089-99709111 TAGCCTCTGATGTGGCTTCCTGG - Intronic
1133063876 16:3192517-3192539 ATCCCACCAATGAGGCTTCCGGG - Intergenic
1135347942 16:21705256-21705278 CAGCCACCTGAGGGGCTTCCAGG + Exonic
1138917932 16:61490345-61490367 TAGATATCAATGTGGCTTCCAGG + Intergenic
1139002322 16:62527687-62527709 TAACCACAAATGGAGCTTGCAGG + Intergenic
1139509566 16:67419324-67419346 CAGACACCAATGGGACATCCAGG - Intergenic
1141952740 16:87349326-87349348 CAGCTGCCACTGGGGCTTCCGGG - Intronic
1142075211 16:88114003-88114025 TAGCCACCCATGGTGCTCGCCGG - Intronic
1143525820 17:7471848-7471870 AAGGCACAAATTGGGCTTCCTGG + Intronic
1145887529 17:28392922-28392944 TACCCACTAATGTGGCTTCAGGG - Intronic
1146673031 17:34755117-34755139 GAGTCACCAAGGAGGCTTCCTGG + Intergenic
1148547569 17:48529516-48529538 TAGCCACCAATGGGGCTTCCAGG - Exonic
1151321393 17:73354675-73354697 TGGCCAACAGTGGGTCTTCCAGG + Intronic
1152632726 17:81417796-81417818 GAGCCAGCCAAGGGGCTTCCCGG + Intronic
1152637052 17:81434549-81434571 TGGCCCCAAGTGGGGCTTCCTGG + Intronic
1154122083 18:11660224-11660246 TATCAGCCAATGGGGCTTTCAGG - Intergenic
1157210660 18:45739413-45739435 TAGGGACCAATGGGAGTTCCCGG + Intronic
1158890319 18:61866261-61866283 TAGCCATCCGTGGGGCTACCTGG - Intronic
1164733043 19:30520291-30520313 GAGCCAGCCAGGGGGCTTCCCGG + Intronic
1165049138 19:33130606-33130628 TGCCCTCCCATGGGGCTTCCTGG - Intergenic
926731370 2:16038252-16038274 TAGGAACCAGTGGGGTTTCCAGG + Intergenic
929795448 2:45055323-45055345 GAGCCACCACTGGGGCCTGCAGG - Intergenic
936088081 2:109483323-109483345 GAGGCACCACTGGGGCTTGCAGG - Intronic
938482540 2:131673595-131673617 CTGCCACCAATGCTGCTTCCAGG + Intergenic
941650881 2:168091412-168091434 TAGCCTCCAATGGGAATTCAGGG - Intronic
948645665 2:239401985-239402007 TGGCAACCAAAGGCGCTTCCGGG - Intronic
1168810075 20:699497-699519 TAGCCTCCAGTTGGGCTCCCTGG - Intergenic
1170124027 20:12942610-12942632 TAACCACAAATGAGGCTTCTGGG - Intergenic
1173836987 20:46132391-46132413 TCTCCACCACTGGTGCTTCCCGG + Intergenic
1174807057 20:53613495-53613517 TAGCGACCGATGAGGCCTCCTGG + Intergenic
1178468217 21:32868718-32868740 CAGTCATCAATGGGGCTCCCTGG + Intergenic
1183190392 22:36318690-36318712 TACCCACCAATGGGGCTGAGAGG + Intronic
954025758 3:47781883-47781905 TAGCCGCCACTGCCGCTTCCCGG + Exonic
960613839 3:119579623-119579645 GAGCCTCCAAGGCGGCTTCCTGG - Exonic
964020567 3:152005358-152005380 TAGTCTCCAGTGGGGTTTCCAGG - Intergenic
965620027 3:170633871-170633893 TGGCCTCCAGTGGGGCTTTCTGG + Intronic
970028345 4:11648549-11648571 GAGCCAACAATGGGGCATCAAGG - Intergenic
982291182 4:153784408-153784430 GAGCCACAAATGGGGCTGACGGG - Intronic
982878875 4:160685854-160685876 TGCCCAGCAAGGGGGCTTCCTGG + Intergenic
987445511 5:18013545-18013567 TAACCACCGATGGGCCTTGCAGG - Intergenic
988525927 5:31987506-31987528 CAGTGACCAAGGGGGCTTCCTGG - Intronic
998719169 5:144923974-144923996 TAGCCACAAATGGGACTGCTGGG - Intergenic
1001781921 5:174376174-174376196 AAGCCACCCAGGGGGGTTCCAGG + Intergenic
1002385599 5:178864183-178864205 TTGCCATGAATGGAGCTTCCAGG - Intronic
1004351423 6:14893433-14893455 AAACCAACAATGGGACTTCCTGG + Intergenic
1004927102 6:20426616-20426638 TGGCCACACATGGGCCTTCCAGG + Intronic
1006600647 6:35223290-35223312 TACCTCCCCATGGGGCTTCCAGG - Intronic
1007378317 6:41470965-41470987 TGGCCACCGTTGGGACTTCCTGG + Intergenic
1010020033 6:71148921-71148943 TACCCAGCAATGGGACTTCTGGG - Intergenic
1012959766 6:105609957-105609979 TCGCTACCAGTGGGGCTTCCTGG - Intergenic
1015663236 6:135600020-135600042 TGGCCACCAATATGTCTTCCAGG + Intergenic
1016514931 6:144883274-144883296 TAGCCACCAACAAGGCTTTCTGG - Intergenic
1022954714 7:35370635-35370657 AAGTCACCCATTGGGCTTCCAGG - Intergenic
1023874519 7:44279525-44279547 TAGCCAGCCAGGGGGCTGCCTGG - Intronic
1027806600 7:82833234-82833256 CAGCCAGGAATTGGGCTTCCAGG + Intronic
1032323627 7:130906157-130906179 TGGCTAGCAAGGGGGCTTCCTGG - Intergenic
1032389427 7:131546386-131546408 TAACCACCTAGGGGGCTGCCAGG + Intronic
1037868797 8:22471679-22471701 TAACCATGAATGGGGCTTACAGG + Intronic
1049753043 8:144294699-144294721 TCCCCACCAATGGGGTCTCCTGG - Intronic
1055004396 9:71488977-71488999 TACCCACCCATGGGGCTCTCAGG + Intergenic
1058657413 9:107236143-107236165 TAGCTACCAATGGGTCTTCCAGG + Intergenic
1061386633 9:130294529-130294551 GAGGCACCAAGAGGGCTTCCTGG + Intronic
1061737519 9:132671187-132671209 TACACACCCAGGGGGCTTCCCGG + Intronic
1186529117 X:10277575-10277597 TAGCCACAAATGGGGTCACCAGG - Intergenic
1191136161 X:57067514-57067536 TAGCCAGAATTGGGGCTTCTTGG + Intergenic
1191879396 X:65829216-65829238 TATCCACCAATGGAGCTATCAGG - Intergenic
1198770243 X:140123299-140123321 TGGCCACCCAGGGGGCTACCAGG + Intergenic
1200064286 X:153497248-153497270 CACCCACCAGTGGGGCTCCCAGG - Intronic
1200126208 X:153816173-153816195 CACCCACCAGTGGGGCTCCCAGG + Intronic