ID: 1148550949

View in Genome Browser
Species Human (GRCh38)
Location 17:48550601-48550623
Sequence CGTCCCGTAGGCGCCCCCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148550941_1148550949 8 Left 1148550941 17:48550570-48550592 CCACGTACACCGGACTGCCCTGC 0: 1
1: 1
2: 0
3: 3
4: 67
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550947_1148550949 -10 Left 1148550947 17:48550588-48550610 CCTGCATGGTGGGCGTCCCGTAG 0: 1
1: 0
2: 2
3: 2
4: 45
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550946_1148550949 -9 Left 1148550946 17:48550587-48550609 CCCTGCATGGTGGGCGTCCCGTA 0: 1
1: 0
2: 1
3: 4
4: 35
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550940_1148550949 9 Left 1148550940 17:48550569-48550591 CCCACGTACACCGGACTGCCCTG 0: 1
1: 1
2: 0
3: 3
4: 44
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550945_1148550949 -1 Left 1148550945 17:48550579-48550601 CCGGACTGCCCTGCATGGTGGGC 0: 1
1: 0
2: 1
3: 18
4: 189
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550938_1148550949 13 Left 1148550938 17:48550565-48550587 CCCGCCCACGTACACCGGACTGC 0: 1
1: 0
2: 0
3: 8
4: 201
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550939_1148550949 12 Left 1148550939 17:48550566-48550588 CCGCCCACGTACACCGGACTGCC 0: 1
1: 1
2: 0
3: 1
4: 51
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550937_1148550949 14 Left 1148550937 17:48550564-48550586 CCCCGCCCACGTACACCGGACTG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550933_1148550949 26 Left 1148550933 17:48550552-48550574 CCGCGTAGCCGCCCCCGCCCACG 0: 1
1: 0
2: 3
3: 30
4: 379
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550936_1148550949 15 Left 1148550936 17:48550563-48550585 CCCCCGCCCACGTACACCGGACT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1148550934_1148550949 18 Left 1148550934 17:48550560-48550582 CCGCCCCCGCCCACGTACACCGG 0: 1
1: 0
2: 5
3: 7
4: 169
Right 1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148550949 Original CRISPR CGTCCCGTAGGCGCCCCCGT TGG Exonic