ID: 1148550992

View in Genome Browser
Species Human (GRCh38)
Location 17:48550744-48550766
Sequence TACCGAAGGCGGGTGGGGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148550992 Original CRISPR TACCGAAGGCGGGTGGGGAC GGG Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903291406 1:22316488-22316510 TACAGAAGGCTGGTGGTGGCGGG - Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906177844 1:43791172-43791194 TACAGAAGGGGAGTGGGTACTGG - Intronic
907518250 1:55006999-55007021 TACATAGGGCGGCTGGGGACTGG - Exonic
910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
914237462 1:145824559-145824581 TACTGAGGCGGGGTGGGGACGGG + Intronic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
921177720 1:212608575-212608597 GGCCGAAGGCGGGTGGAGAGAGG - Intronic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1066405843 10:35117235-35117257 TCACGAAGGCTGGTGTGGACTGG + Intergenic
1067495298 10:46756147-46756169 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG + Intergenic
1072021632 10:91409502-91409524 AAACGTAGGCGCGTGGGGACGGG + Intergenic
1072111337 10:92323024-92323046 TAAAGAAGGTGGCTGGGGACCGG - Intronic
1075399205 10:122149496-122149518 TGCCCAGGGCGGGTGGGGCCGGG - Intronic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1081454989 11:43212578-43212600 TACCGAACTCGGGAGGGGAGGGG - Intergenic
1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG + Intronic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1096656628 12:53096580-53096602 TGGGGAAGGCGGGTGGGGAGCGG + Intergenic
1097243239 12:57590849-57590871 TACCGAATGGGGGTTGGGAAGGG - Intergenic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1105994249 13:25654968-25654990 TACCGAAGGGTGATGTGGACAGG + Intronic
1112023312 13:95390788-95390810 TACAGAAGGCGGAAGGGGAGAGG - Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1119046171 14:71320668-71320690 TACCGCATGGGGGAGGGGACAGG - Intronic
1122409445 14:101518444-101518466 GACGGAAGGCCAGTGGGGACAGG + Intergenic
1127332022 15:57948985-57949007 GTGCCAAGGCGGGTGGGGACAGG - Intergenic
1129737567 15:77974690-77974712 TACTGAAGGCAGGTGTGGAGAGG - Intergenic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1137586397 16:49666321-49666343 TGTCGAAGGCAGGTGGGGAATGG - Intronic
1138041223 16:53670216-53670238 TACCCAAGGAGTGTGGGGATAGG - Intronic
1141802446 16:86320034-86320056 TGCCGAAGGTGGGAGGGGGCGGG - Intergenic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1142109296 16:88322763-88322785 TCCTGAAGGTGGGTGGGCACGGG - Intergenic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1152509260 17:80774194-80774216 AACTCAAGGCGGGTGGAGACGGG - Intronic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1157752913 18:50194658-50194680 TACTGGAGGCGGGAGGTGACGGG - Intronic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG + Intronic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG + Exonic
1165471548 19:36007327-36007349 TACAGAAGAGGGGTGGGGATGGG - Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG + Exonic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
925399018 2:3558505-3558527 TCCCGAAGGCGGGCGAGGTCTGG + Exonic
927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG + Intronic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
946250325 2:218407424-218407446 CATGGAAGGCGGGTGAGGACAGG + Intergenic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG + Intergenic
1175901886 20:62363207-62363229 TTCCGGAGGCCTGTGGGGACCGG + Intronic
1181964368 22:26646262-26646284 TCCAGAAGGCAGGTAGGGACTGG - Intergenic
1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG + Intergenic
1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG + Intronic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
962964207 3:140338560-140338582 TACTGAGGCCGGGGGGGGACTGG - Intronic
963253058 3:143119916-143119938 TACCGGGGGCGGGTTGGGTCGGG + Exonic
968904830 4:3446361-3446383 GTCCGCAAGCGGGTGGGGACAGG - Intronic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1007923826 6:45635023-45635045 CACAGAAGGCTGGTGGGAACCGG + Intronic
1008218572 6:48825944-48825966 TACCTAAGGCTGGTGGGAAATGG + Intergenic
1010472784 6:76249562-76249584 CACAGAAGACGGGTGGGGATGGG + Intergenic
1014187974 6:118457588-118457610 AACAGAAGGCGGGTGGGGGTGGG - Intergenic
1018695852 6:166390904-166390926 TACCAATGGTGGGTGGAGACAGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG + Exonic
1056574109 9:87842275-87842297 GACCCTAGGAGGGTGGGGACTGG - Intergenic
1187741080 X:22355982-22356004 TTCCGAAGGGGTGTGGGGAGAGG + Intergenic
1190261743 X:48801991-48802013 GACCGAAGGCGGCTAGGGACTGG + Exonic
1195945723 X:110209079-110209101 TTCCAAAGGCTAGTGGGGACAGG + Intronic