ID: 1148554515

View in Genome Browser
Species Human (GRCh38)
Location 17:48570345-48570367
Sequence TAGAATCAGAGTTCTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148554507_1148554515 9 Left 1148554507 17:48570313-48570335 CCCCCATCCAAACTTGACCAGTT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554511_1148554515 2 Left 1148554511 17:48570320-48570342 CCAAACTTGACCAGTTACGTGCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554506_1148554515 10 Left 1148554506 17:48570312-48570334 CCCCCCATCCAAACTTGACCAGT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554509_1148554515 7 Left 1148554509 17:48570315-48570337 CCCATCCAAACTTGACCAGTTAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554512_1148554515 -8 Left 1148554512 17:48570330-48570352 CCAGTTACGTGCAACTAGAATCA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554510_1148554515 6 Left 1148554510 17:48570316-48570338 CCATCCAAACTTGACCAGTTACG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160
1148554508_1148554515 8 Left 1148554508 17:48570314-48570336 CCCCATCCAAACTTGACCAGTTA 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148554515 Original CRISPR TAGAATCAGAGTTCTCGGCC GGG Intronic
900174750 1:1286729-1286751 TGGAGTCAGAGTTGCCGGCCCGG - Intronic
905625543 1:39488556-39488578 TATAATCACAGTCCTGGGCCGGG + Intergenic
906386904 1:45377712-45377734 TAGAATCCTTGTTCTTGGCCGGG - Intronic
906928297 1:50142496-50142518 TAAAATCTGAGTTCTAGGCCAGG - Intronic
907407435 1:54262319-54262341 TAGAATCAGACATCGAGGCCTGG - Intronic
909783337 1:79577318-79577340 TATAAAAAGATTTCTCGGCCGGG - Intergenic
910231273 1:84989999-84990021 AAGAATCAAACTTCTGGGCCGGG + Intronic
916032134 1:160886534-160886556 TAGAAATAGAGGTCTCAGCCAGG + Intergenic
918052980 1:180990766-180990788 TAAAGTCAGAGTTCTCCACCAGG + Intronic
921559313 1:216638352-216638374 TAGACTCAGAGTTCACTGTCAGG - Intronic
923479888 1:234373940-234373962 CAGAACCACAGTTCTCAGCCGGG + Intronic
1063255972 10:4327840-4327862 TAGAAATAGAGTTATAGGCCAGG + Intergenic
1064518953 10:16181083-16181105 TAGAAACAAAGATCTTGGCCAGG + Intergenic
1065508213 10:26450989-26451011 CAGAATCTGAGTTCTAGGCCAGG - Intronic
1065674198 10:28156912-28156934 TAGAAAAAGAGTAATCGGCCAGG + Intronic
1066366700 10:34783911-34783933 TAAAATCAGTATTCTAGGCCAGG + Intronic
1069932867 10:71894586-71894608 TATAAACAGTGTTCTCGGCTGGG - Intergenic
1070199015 10:74185535-74185557 TTGAAGCAGAGTCGTCGGCCGGG + Intronic
1072061905 10:91821325-91821347 TAAACTGAGAGTTCTAGGCCAGG - Intronic
1073394096 10:103204002-103204024 TAGAAAAAAAGTTCTAGGCCAGG + Intergenic
1074675353 10:115842768-115842790 TAGAATCAGAGTTCCAGTCCTGG + Intronic
1078263078 11:9729785-9729807 GAAAGTCAGAGCTCTCGGCCAGG - Intronic
1078278693 11:9877032-9877054 TATAAACAAAGTTCTAGGCCAGG - Intronic
1078943306 11:16033573-16033595 TAAGATCAGAGAACTCGGCCAGG + Intronic
1079762102 11:24342062-24342084 TAAAAATAAAGTTCTCGGCCAGG + Intergenic
1080612770 11:33918952-33918974 TAAAAAAAGAGTTCTTGGCCGGG - Intergenic
1082070796 11:47938069-47938091 TAGAATCAAAGCTCCTGGCCAGG + Intergenic
1084581485 11:70026706-70026728 TTGAATCAGAGTTCTGTTCCAGG + Intergenic
1085254017 11:75162195-75162217 TAGGATCAGAGATCTGGGGCAGG - Intronic
1089720717 11:120417789-120417811 TAGAATCAGAGATTCTGGCCAGG - Intronic
1091882607 12:3991501-3991523 TAGCTTCACAGTTCTCTGCCAGG - Intergenic
1093058450 12:14578489-14578511 TAGAGACAGAGTTGTTGGCCAGG - Intergenic
1093503978 12:19843497-19843519 AAGAAAAAGAGTTCTAGGCCGGG + Intergenic
1096708907 12:53441362-53441384 TATAGACAGAGTTCTCGGCAAGG - Intergenic
1097832988 12:64245230-64245252 TACAATCAGAGTCCTCGCCAAGG - Intergenic
1099260045 12:80367268-80367290 TAGAATATGAGCTCTTGGCCAGG - Intronic
1101330575 12:103754652-103754674 AAGAATTAGAGTTCTAGGCCAGG + Intronic
1101462724 12:104913261-104913283 TGAAAACTGAGTTCTCGGCCAGG + Intronic
1102742077 12:115216831-115216853 TAGAAATAGTGTCCTCGGCCAGG + Intergenic
1104178083 12:126351929-126351951 TGGAATCAGGTTTCTTGGCCAGG - Intergenic
1104244837 12:127028962-127028984 TAAAATCATAGTTATAGGCCAGG - Intergenic
1106326919 13:28700596-28700618 TAGAGGCAGAATTCTCAGCCAGG + Intronic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1109123150 13:58483847-58483869 TAGAAACCACGTTCTCGGCCAGG - Intergenic
1109305680 13:60638212-60638234 TAAAAGTAGAGTTTTCGGCCAGG + Intergenic
1110343788 13:74422952-74422974 AAGAATCAGATTTGTCAGCCTGG - Intergenic
1111173251 13:84557904-84557926 TAGAATCAGACTTCACGGTCAGG + Intergenic
1113560807 13:111279262-111279284 TAGGATGAGATTTCTCAGCCTGG + Intronic
1113860022 13:113475886-113475908 GACAATCAGACTTCTGGGCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1118510211 14:66463880-66463902 TAGAATAAGAATTCAGGGCCCGG - Intergenic
1119632376 14:76244227-76244249 AAGAACCAGAGTTCTTGGCCAGG + Intronic
1120908150 14:89639045-89639067 TAGAATCAGAGTTGTGGAGCTGG - Intronic
1122032984 14:98927055-98927077 TCCCATCAGAGTTCCCGGCCTGG + Intergenic
1122749312 14:103921115-103921137 TGGAGTCAGAGTTCTTGGCTTGG + Exonic
1124996974 15:34732851-34732873 TAGAATCAGAGATGTCTGGCAGG - Intergenic
1125438879 15:39679439-39679461 AAAAATAAGAGTTCTGGGCCAGG + Intronic
1125683957 15:41551622-41551644 TAGAAACCGAGATCTGGGCCAGG + Intergenic
1128423604 15:67518566-67518588 TAGAAATGTAGTTCTCGGCCGGG - Intergenic
1129328356 15:74813829-74813851 TAAAATGTGAGTTCTTGGCCAGG + Intronic
1129494729 15:75967755-75967777 AAGAATCAGATTTTGCGGCCAGG - Intronic
1129996043 15:80007065-80007087 TAGAACCAGTGTACTCAGCCTGG + Intergenic
1131092358 15:89632363-89632385 TAGAAAGAGACTTCTCCGCCTGG - Intronic
1131107257 15:89743711-89743733 TTCAACCAGAGTCCTCGGCCTGG + Intergenic
1131523615 15:93135482-93135504 TAGAAACTGAGTTATTGGCCAGG - Intergenic
1133943325 16:10328446-10328468 TAGAATCTGGGCTCTAGGCCAGG - Intronic
1135034531 16:19066023-19066045 TAGAAACAGAGACCTAGGCCAGG + Intergenic
1135776825 16:25263993-25264015 TAAAATAAGAGTTCCTGGCCAGG - Intergenic
1136018392 16:27423017-27423039 AAGAATTAGAGTTCAGGGCCTGG - Intronic
1137943870 16:52715677-52715699 TTAAATAAGAGTTCTCGGCCGGG + Intergenic
1138500915 16:57443640-57443662 TAGCAACAGAGTTGTTGGCCAGG + Intronic
1142750276 17:1983339-1983361 AAGAATGTGAGGTCTCGGCCAGG - Intronic
1142800915 17:2345165-2345187 GAGTATTAGAATTCTCGGCCGGG + Intronic
1143694310 17:8600063-8600085 TAGAATCAGGGCTCACGGTCAGG + Intronic
1146136161 17:30322793-30322815 TAGAATAAGAGCTGTCAGCCAGG - Intronic
1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG + Intronic
1148852082 17:50560379-50560401 AAGAATCAGAGTATTCGGCGCGG - Intergenic
1149097305 17:52858962-52858984 TAAAATTAGAGTTATAGGCCAGG + Intergenic
1150536175 17:66044107-66044129 TAGAATGAAAGTTCTCTGACAGG + Intronic
1152446839 17:80349816-80349838 TAGAATCAGAGGTCACAGGCAGG + Exonic
1155014089 18:21814867-21814889 AAGAATCAGGGTCCTAGGCCAGG - Intronic
1157698210 18:49741752-49741774 TAAAATGTGAGTTTTCGGCCAGG + Intergenic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1162221389 19:9179708-9179730 TAATATAATAGTTCTCGGCCGGG + Intergenic
1164957567 19:32400198-32400220 TAGAATATGAGTTCTAGGGCTGG + Intergenic
1165636789 19:37347110-37347132 TAGAATGAGAGGTCAAGGCCAGG - Intronic
1165719394 19:38068322-38068344 AAGAATCTGATTTTTCGGCCGGG - Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1168083331 19:54026721-54026743 CAAAATCAGGGTTCTCGGCTGGG - Intergenic
925469810 2:4147826-4147848 TAGAAAATGAGGTCTCGGCCGGG - Intergenic
925635964 2:5941658-5941680 TAGAATCAGAGTCCTTTGCATGG + Intergenic
927065055 2:19462879-19462901 AAGAATGGGAGCTCTCGGCCGGG + Intergenic
927900297 2:26814028-26814050 TAGAAACAGAATTCCAGGCCGGG + Intergenic
931883321 2:66589392-66589414 TAGTATCAGAGTTCTCGTTCTGG + Intergenic
934084197 2:88496180-88496202 TAAAATCACAGTGCTCAGCCAGG - Intergenic
935407469 2:102724121-102724143 TAGGATCAGAGTGCTAGGCCAGG - Intronic
936034429 2:109099541-109099563 TAAAAACTGAGTTCTGGGCCAGG - Intergenic
944461442 2:199954719-199954741 TAGAATTACAGTTCTGGGGCCGG - Intronic
946286665 2:218709018-218709040 TAAAAACTGAGTTCCCGGCCGGG - Intergenic
1169574416 20:6942372-6942394 TAGAATCAGAGTTCTGGGGAAGG + Intergenic
1170310961 20:14990805-14990827 AAGAAACATAGTTCTCAGCCGGG - Intronic
1172709839 20:36913290-36913312 AAGAATGAAAGTTCTTGGCCGGG - Intronic
1172711178 20:36924861-36924883 AAAAATTAGATTTCTCGGCCGGG + Intronic
1172922305 20:38495030-38495052 GAGAATTAGAGTTCTCTTCCTGG + Intronic
1172989276 20:39020956-39020978 TAGAATCCTGTTTCTCGGCCAGG - Intronic
1175153486 20:56953645-56953667 CAAAATCAAAGGTCTCGGCCGGG + Intergenic
1178080534 21:29059072-29059094 TAGAATGACAGTTCTCAGCCAGG - Intronic
1179637500 21:42722804-42722826 TAGAATCAGAATTATGGGTCAGG + Intronic
1180019617 21:45113666-45113688 AAGTATCAGAGAGCTCGGCCAGG - Intronic
1182699531 22:32224213-32224235 TTAAATAAGAGTTCTTGGCCGGG - Intronic
1183018930 22:35011820-35011842 TAAAAGCAGAGTCCTGGGCCGGG + Intergenic
1183583666 22:38739920-38739942 TGGAATCTCAGTTCCCGGCCTGG - Exonic
1184627731 22:45750389-45750411 TAAAATCACTGTTGTCGGCCGGG - Intronic
949356235 3:3183138-3183160 CAAAATCAGAGTTCTTGGCAAGG - Intergenic
949506178 3:4729949-4729971 TGCAATCAGATTTCTCAGCCTGG + Intronic
953402431 3:42636724-42636746 GTGAATCAGAGTTATAGGCCTGG - Intronic
954080352 3:48210017-48210039 TAGAATTGGTGCTCTCGGCCGGG - Intergenic
955609682 3:60743899-60743921 TGGAATCAGAATTCTCCTCCAGG - Intronic
958625734 3:96619829-96619851 TAGAGGCAGAGCTCTCGCCCGGG + Intergenic
958991369 3:100849517-100849539 CAGAATTAAAGTTCTGGGCCGGG - Intronic
962585949 3:136843026-136843048 AAAAATCAGAGTTCTGGGCCAGG + Intronic
964549215 3:157868226-157868248 TAGAATTAGAACTCTAGGCCTGG + Intergenic
965883297 3:173413304-173413326 AAAAATGAGACTTCTCGGCCGGG + Intronic
966953852 3:184852720-184852742 AACAAACAGAGTTCTGGGCCTGG + Intronic
967270439 3:187728366-187728388 TAGAATCTGAGTACTCAGACTGG + Exonic
971738929 4:30495932-30495954 TAAAATCAGGGTCCTCGGCCAGG - Intergenic
972282041 4:37611878-37611900 GAGAAGCAGGGTTCTAGGCCGGG + Intronic
972727712 4:41760015-41760037 TAAAATAAGAGTTTTGGGCCGGG - Intergenic
974694143 4:65343260-65343282 TTGAATCAGAGTTCATGGTCTGG + Intronic
975137937 4:70892651-70892673 TAGAAACAGCGTTGTGGGCCGGG + Intergenic
975329109 4:73093668-73093690 TAGAATTTGAGTTCTTGGGCTGG - Intronic
976865539 4:89722015-89722037 TAGAATTAGAAATCTTGGCCAGG + Intergenic
977675342 4:99741054-99741076 TTAAATCAGAGATCTCAGCCGGG + Intergenic
980119945 4:128717437-128717459 TAGAAGCAGAGTTCTCTTCCAGG - Intergenic
985284952 4:188327745-188327767 TAGAATCAGAGATCTAGGGTGGG - Intergenic
991033139 5:62102776-62102798 TAGAAGTAGAGTCCTGGGCCGGG - Intergenic
991664606 5:68986198-68986220 AAGAATCAGGGTTCTTGGCCGGG + Intergenic
991677514 5:69102562-69102584 GAAAATAAGAGTTCTCGGCCAGG + Intronic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992856887 5:80871182-80871204 TAGCCTCAGAGTTCTCTGCAGGG - Intronic
996391187 5:122963945-122963967 TAGAACAATAGTTCTGGGCCGGG + Intronic
996649825 5:125861443-125861465 TAAAATGTCAGTTCTCGGCCGGG - Intergenic
998571728 5:143265467-143265489 CAGAATCAGAGTTCTCTGTAAGG - Intergenic
1000136509 5:158357623-158357645 AATAATTAGAGTTTTCGGCCAGG - Intergenic
1001610095 5:172993557-172993579 AAAAATAAGAGTTCTGGGCCAGG + Intronic
1001628078 5:173153520-173153542 CATAAACAGTGTTCTCGGCCGGG - Intronic
1001921459 5:175603401-175603423 TAGAATAAGAATTCTTGGCCAGG + Intergenic
1003044286 6:2718675-2718697 TAGAAACAGAGCTCTATGCCTGG - Intronic
1003211234 6:4068973-4068995 TTGAATGAGAGTTCTTGGCATGG + Exonic
1005835122 6:29702933-29702955 TAGAATGAGAGTCCAGGGCCTGG + Intergenic
1011800072 6:91002856-91002878 TAGAATGAGGTTTCTCAGCCTGG - Intergenic
1015561110 6:134517125-134517147 TAGAATCCGAGTTGTTGGCCAGG + Intergenic
1015591169 6:134824275-134824297 TAAAATCCAAGTTTTCGGCCAGG - Intergenic
1017805027 6:157938001-157938023 CAGCATCAGAGTTGTAGGCCTGG + Intronic
1017902123 6:158727464-158727486 AAGAATGAAAGTTCTAGGCCGGG - Intronic
1019375558 7:689974-689996 TAAAAACTGTGTTCTCGGCCAGG - Intronic
1020788678 7:12598595-12598617 TAAAAACAGTGTTATCGGCCTGG + Intronic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1023452569 7:40303327-40303349 TAGAAACAGCTTTCTTGGCCGGG - Intronic
1025263007 7:57433793-57433815 TAGAAACAGTTTTCTCTGCCGGG + Intergenic
1027238178 7:76310437-76310459 GAGAACCAGAGGTCTCGACCAGG - Intergenic
1027632436 7:80623202-80623224 TAGAATGAATGTTCTCGACCAGG + Intronic
1030305546 7:108015015-108015037 TAAAATCTCAGTTCTAGGCCGGG - Intergenic
1032727668 7:134606087-134606109 TAAAATCAAACTTCTTGGCCAGG - Intergenic
1038142258 8:24858810-24858832 TAAAATCGGAGTTCTTGGCTGGG - Intergenic
1044351824 8:91175544-91175566 TTGAATCAGAGTTTGTGGCCAGG + Intronic
1045211423 8:100104020-100104042 TAAAAGCAGAGCTCTGGGCCTGG + Intronic
1045468042 8:102487380-102487402 TAAAATCAGGGTCCTCGGCCTGG - Intergenic
1047593729 8:126354547-126354569 AAGATTCAGAGTACTAGGCCAGG - Intergenic
1050064797 9:1748394-1748416 TAGAACCAGAATTCTAGCCCTGG + Intergenic
1057030628 9:91772501-91772523 TAGTATCACAGTTCTGAGCCTGG - Intronic
1057797758 9:98170736-98170758 CAGAATTAGGATTCTCGGCCAGG - Intronic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG + Intergenic
1058824316 9:108761268-108761290 TAGAATAAGAGTACTGGGCTGGG - Intergenic
1062420130 9:136476721-136476743 CAGGATCAGAGTTATTGGCCAGG + Exonic
1187370802 X:18704346-18704368 TTGCATCAAAGTTCTCGGCATGG + Intronic
1190512003 X:51182698-51182720 GGGAATCAGAGCTCTGGGCCAGG - Intergenic
1193524852 X:82576536-82576558 TAGAATAAGAGTTCTAAACCAGG - Intergenic
1197642464 X:128981996-128982018 TAGTTTAAGAGTTTTCGGCCAGG - Intergenic