ID: 1148555667

View in Genome Browser
Species Human (GRCh38)
Location 17:48577388-48577410
Sequence TGGAATCTGAGCAGCAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148555667_1148555675 26 Left 1148555667 17:48577388-48577410 CCACCCTTGCTGCTCAGATTCCA 0: 1
1: 0
2: 1
3: 19
4: 382
Right 1148555675 17:48577437-48577459 TTTGCTCACTTCTCCAGCCAAGG 0: 1
1: 0
2: 1
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148555667 Original CRISPR TGGAATCTGAGCAGCAAGGG TGG (reversed) Intronic
900298013 1:1961983-1962005 TGGAGCCTGGGCAGCAAGGGGGG + Intronic
900574699 1:3377298-3377320 TGGATTCTGAGCATGCAGGGAGG - Intronic
901047820 1:6408933-6408955 TGGAATCCCAGCTGCACGGGAGG - Intergenic
901127469 1:6939695-6939717 TGAGATCTGAGCAGCAAGAAGGG - Intronic
901297698 1:8173298-8173320 TGCAATCTGAGCTGCTCGGGAGG - Intergenic
901403933 1:9033488-9033510 TGGAATCTCAGCACTTAGGGAGG - Intergenic
901463804 1:9407558-9407580 TGTAATCTCAGCACCATGGGAGG + Intergenic
901539685 1:9907883-9907905 TGGATTCTAAGGAGCAAAGGTGG - Intronic
902175597 1:14647878-14647900 GGGAATCTTAACAGAAAGGGTGG + Intronic
902414091 1:16228886-16228908 TGGATCCTGAGAGGCAAGGGTGG - Intergenic
902597296 1:17518243-17518265 TGGTGTCTGAGCAGAAAGTGGGG + Intergenic
903766350 1:25737327-25737349 TGGCATCTGCTCAGGAAGGGTGG + Intronic
904673198 1:32181098-32181120 TGGAAACTGAGAAGCAAGAATGG - Intronic
904917947 1:33983894-33983916 TGGAATCCCAGCACCAAGGGAGG + Intronic
905547938 1:38814757-38814779 TGGAAGCTGACAAGCAAGTGTGG + Intergenic
908256665 1:62308863-62308885 TGGCATCTAAGCAGCTGGGGTGG + Intronic
908568148 1:65380284-65380306 TGGAATCTGAGCATTAATGCTGG + Intronic
909623147 1:77687674-77687696 TGGAATGTGAGGAGCAAGTCGGG + Intergenic
911596419 1:99803078-99803100 TGGAGTCCCAGCAGCTAGGGAGG + Intergenic
914709894 1:150203480-150203502 TGTAATCTGAGCACCTTGGGAGG - Intergenic
914891260 1:151625578-151625600 TGTAATCTGAGCACTATGGGAGG + Intronic
915464431 1:156088228-156088250 TGGACTCTTAGCAGAAAGGACGG - Intronic
915554464 1:156653705-156653727 TGGGATCTTAGCAGCCAGGAAGG - Intronic
915913115 1:159926266-159926288 TGGAATCTCAGGTTCAAGGGAGG - Intergenic
916961235 1:169892378-169892400 TGTAATCTCAGCAACTAGGGAGG - Intronic
917120918 1:171643847-171643869 TGTAATCTCAGCAACTAGGGAGG + Intronic
918113931 1:181481803-181481825 TGGTATCTGAGCTGCAGAGGTGG - Intronic
920356762 1:205379087-205379109 TTCATCCTGAGCAGCAAGGGAGG - Intergenic
923542940 1:234901734-234901756 AGGAATCAGAGCAGGAAGAGAGG - Intergenic
923658788 1:235940971-235940993 AGGAATCTGAGCATCAAGGAAGG - Intergenic
924171897 1:241351160-241351182 TGTAATCTCAGCAGTATGGGAGG + Intronic
924394450 1:243604149-243604171 TGGAATCTCAGCACTATGGGAGG - Intronic
924941359 1:248814266-248814288 TGGAATATGGGAAGCAATGGAGG + Intronic
924947569 1:248856537-248856559 TGGAATCTGAGCATGATGAGAGG - Exonic
1065573590 10:27097058-27097080 TGGAATCTCAGCTACTAGGGAGG + Intronic
1065999346 10:31089868-31089890 TGCAATCTGAGCTACACGGGAGG + Intergenic
1066281029 10:33918598-33918620 TGGAAGCAGAGCAGCAAAGAAGG - Intergenic
1067396526 10:45924975-45924997 TGTAATCTCAGCAGCTTGGGAGG - Intergenic
1067695054 10:48528544-48528566 TGGGACCTGAGCTGCAAGGAGGG + Intronic
1067864847 10:49894084-49894106 TGTAATCTCAGCAGCTTGGGAGG - Intronic
1069882812 10:71604158-71604180 TGTAATCTAAGCAACATGGGAGG + Intronic
1070511128 10:77161499-77161521 TGTAATCTCAGCAGCTTGGGAGG - Intronic
1070712102 10:78690206-78690228 TGTAATCTGAGCACCTTGGGAGG - Intergenic
1071965293 10:90845808-90845830 TGGCTTCTGGGCACCAAGGGTGG - Intronic
1072169819 10:92848505-92848527 TGGAAGCTGAGGAGCCAGCGAGG - Exonic
1072723371 10:97795054-97795076 TGTAATCTGAGCACTATGGGAGG - Intergenic
1072923865 10:99599018-99599040 TGGAATCTGAGCAAGCAAGGAGG - Intergenic
1074311703 10:112328062-112328084 TGGAATCTCAGCAGTTTGGGAGG + Intergenic
1074363337 10:112839573-112839595 TGGAATCAGAGAGACAAGGGTGG + Intergenic
1074398886 10:113125057-113125079 TGGAATCTGGGGAATAAGGGTGG + Intronic
1074908797 10:117888445-117888467 TGTAATCCCAGCAGTAAGGGAGG + Intergenic
1076226752 10:128782846-128782868 TGGAATCTGATTAGCTTGGGTGG - Intergenic
1076386752 10:130062657-130062679 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
1076504998 10:130965909-130965931 TGTAATCTGAGCAACTCGGGAGG + Intergenic
1077299087 11:1839010-1839032 TAGAATCTGGGCAGCAGGGCTGG - Intronic
1077651216 11:3974417-3974439 TGTAATCTGAGCACCTTGGGAGG + Intronic
1078204655 11:9218004-9218026 TGTAATCTCAGCACCAAGGTGGG + Intronic
1078897226 11:15607377-15607399 GGGTATCTGAGGAGCCAGGGAGG + Intergenic
1079593208 11:22206568-22206590 TGTAATCTCAGCACCTAGGGAGG - Intronic
1079764531 11:24374990-24375012 TGGAAACTGAGAAGCATGGGAGG - Intergenic
1080492388 11:32780150-32780172 TGTAATCTCAGCTACAAGGGAGG + Intronic
1080582605 11:33656461-33656483 TGGTGTCTGAGAAGCCAGGGAGG + Intronic
1080742897 11:35082396-35082418 AGGAATGTGAGCAGCCAGGATGG - Intergenic
1081299016 11:41427787-41427809 TGGAATCTCATCAGTAAGGCAGG - Intronic
1081436367 11:43031932-43031954 TGGCATCTATGCAGGAAGGGTGG - Intergenic
1081872778 11:46391055-46391077 TGGAGGCTGGGCAGCAAAGGGGG + Intergenic
1082283039 11:50291199-50291221 TGTAATCTGAGCTACTAGGGAGG - Intergenic
1082665654 11:55972331-55972353 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1083278913 11:61613549-61613571 TGGAATCTGGTCAGCAAGCAGGG + Intergenic
1083367934 11:62152676-62152698 TTGCACCTGAGCAGCACGGGTGG - Exonic
1083402562 11:62434104-62434126 TGGTTTCTGTGCGGCAAGGGTGG + Intronic
1084119372 11:67059963-67059985 TGGATTCAGGGCAGCAGGGGAGG + Intronic
1084383378 11:68827636-68827658 TGTAATCTCAGCAGCTTGGGAGG - Intronic
1084671634 11:70610334-70610356 TTGCAGCTGAGCAGCAAGAGGGG - Intronic
1085026145 11:73237755-73237777 TGGGCACTGAGCAGCAAGGTGGG - Intergenic
1085126286 11:74004731-74004753 TGGAATCTGCTCAGCTGGGGTGG - Intronic
1086856423 11:91871518-91871540 TGGAATCCAGGCAGCAAAGGAGG + Intergenic
1089356031 11:117854445-117854467 TTGAACCTGAGCATCAATGGAGG - Intronic
1091764084 12:3107002-3107024 TGGGATCTGAGCAGCCAGGAGGG - Intronic
1092407091 12:8228619-8228641 TGGAATCTCAGCACTTAGGGAGG - Intergenic
1093026921 12:14253887-14253909 TGTAATCTGAGCTACTAGGGAGG - Intergenic
1094361559 12:29636786-29636808 TGTAATCTGAGCACCTTGGGAGG + Intronic
1094687676 12:32734684-32734706 TGTAATCTGAGCTACTAGGGAGG + Intronic
1094723773 12:33091388-33091410 TGGAATGTGAACAGAAATGGCGG + Intergenic
1098088876 12:66879604-66879626 AGGAAGCTGAACAGCAAAGGAGG + Intergenic
1098385277 12:69911986-69912008 TGGCTTCTGACCAGCAAGGTTGG - Intronic
1098840982 12:75477696-75477718 TGGAATCTAATCAGGAAGTGTGG + Intergenic
1100518136 12:95347975-95347997 TGTAATCTCAGCTACAAGGGAGG - Intergenic
1101590917 12:106124611-106124633 TGGAATGTAAGCTGCAAGGAAGG + Intronic
1101599941 12:106200472-106200494 TGTAATCTCAGCTGCTAGGGAGG - Intergenic
1102662148 12:114538570-114538592 TGTAATCCCAGCAGCATGGGAGG + Intergenic
1103134886 12:118498688-118498710 TGTAATCTCAGCAGTATGGGAGG + Intergenic
1103871775 12:124097416-124097438 TGTAATCTGAGCACTATGGGAGG - Intronic
1104250653 12:127089979-127090001 TGTAATCTGAGCTGCTTGGGAGG + Intergenic
1104809006 12:131609228-131609250 TGCAGGCTGAGCAGGAAGGGCGG - Intergenic
1107345171 13:39452540-39452562 TGGGATCTGTGAAGAAAGGGAGG - Intronic
1107860503 13:44655789-44655811 TGCGAGCTGAGCAGCAAGGTGGG - Intergenic
1108044375 13:46369334-46369356 TGTAATCTCAGCTGCTAGGGAGG - Intronic
1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG + Intronic
1109692752 13:65914311-65914333 TGCAAGCTGAGGAGCAAGGAGGG - Intergenic
1109953506 13:69534144-69534166 TGTAATCTGAGCAGTTTGGGAGG - Intergenic
1110207222 13:72929450-72929472 TTGAATTTGAGGAGCAAAGGAGG + Intronic
1110240404 13:73260232-73260254 TGGATTCAGAGCAGAAAAGGGGG - Intergenic
1110543851 13:76735091-76735113 TGGAATATGAGCAGGACAGGAGG - Intergenic
1111440625 13:88279507-88279529 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
1111475093 13:88735476-88735498 TGGAATCTCAGCAGTTTGGGAGG + Intergenic
1112250500 13:97774728-97774750 TGCAATCTGAGCACCTCGGGAGG - Intergenic
1112503241 13:99957765-99957787 TGGAATCTGAGCGCAATGGGTGG - Intergenic
1112752182 13:102594713-102594735 TGTAATCTGAGCACCTTGGGAGG + Intergenic
1112893004 13:104261791-104261813 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1113593689 13:111517569-111517591 TGGAATAACAGCAGAAAGGGAGG + Intergenic
1113807031 13:113115935-113115957 TGGGATCTGGGCACCAAGGGTGG + Intronic
1114634831 14:24181660-24181682 TGGAAGCTGAGGAGGGAGGGTGG - Intronic
1115144964 14:30215877-30215899 TGGAATCTGATCATCTAGAGAGG - Intergenic
1115209060 14:30946420-30946442 TGGAATCTGAGCAACTCAGGAGG + Intronic
1116663589 14:47745564-47745586 TGGAATCTCAGCTGCTAGGTTGG + Intergenic
1117156462 14:52946792-52946814 TGGAATCTCAGCTGCTTGGGAGG - Intronic
1117453318 14:55873247-55873269 TGGAAAATGAGCAGCCAAGGAGG - Intergenic
1117473173 14:56067296-56067318 TGGAACTTAAGAAGCAAGGGTGG + Intergenic
1117934748 14:60890525-60890547 TGCAAGCTAAGGAGCAAGGGAGG + Intronic
1118569984 14:67184785-67184807 TGGCATCTGAAATGCAAGGGTGG + Intergenic
1119894419 14:78207651-78207673 AGGAATCTGAGCTGGAAAGGTGG + Intergenic
1120363837 14:83540827-83540849 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1120706448 14:87750878-87750900 TGCAATCTTAGCAGCAAATGGGG - Intergenic
1121583618 14:95048287-95048309 TGGAATGAGATCATCAAGGGAGG - Intergenic
1121768790 14:96512294-96512316 TGTAATCTGAGCTATAAGGGAGG + Intronic
1125833379 15:42731326-42731348 TGGAAGCTGAGAAGAAGGGGTGG + Exonic
1126105241 15:45142967-45142989 TGGAATCTGAGGAGGAAGGGTGG + Intronic
1128667724 15:69550797-69550819 TGGAGTCAGAGCATAAAGGGTGG + Intergenic
1129288793 15:74547278-74547300 TGTAATCTCAGCTGCTAGGGAGG - Intronic
1130070517 15:80643263-80643285 TGGAATCTCAGCAGTTTGGGAGG - Intergenic
1130863533 15:87912027-87912049 AGGAATATTAGAAGCAAGGGAGG - Intronic
1131026628 15:89147995-89148017 TGTAATCTGAGCTTCTAGGGAGG + Intronic
1131727682 15:95244576-95244598 TGTAATCCCAGCAGTAAGGGAGG - Intergenic
1132072801 15:98794402-98794424 AGCAATCTGAGCACCACGGGGGG - Intronic
1132097210 15:98996379-98996401 AGCATTGTGAGCAGCAAGGGGGG - Intronic
1132745197 16:1433538-1433560 TGCAGTGGGAGCAGCAAGGGTGG + Intergenic
1133740431 16:8647082-8647104 GGAAACCTGAGCTGCAAGGGAGG - Exonic
1134258751 16:12633608-12633630 TGGAATCTCAGCAGTTTGGGAGG + Intergenic
1134684513 16:16149228-16149250 TGTAATCTCAGCTGCACGGGAGG + Exonic
1136114091 16:28083732-28083754 TGGAATCTCAGCACTTAGGGGGG - Intergenic
1136117094 16:28101382-28101404 TGGCACCTGTGCAGCAAGGAGGG - Intronic
1136928168 16:34394603-34394625 TGCAAGCTGAGGAGCAAGGAAGG + Intergenic
1136976406 16:35017201-35017223 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
1137053865 16:35734379-35734401 TGGAACCTGGGCTGCCAGGGCGG - Intergenic
1137235106 16:46610070-46610092 TGTAATCTGAGCTACTAGGGAGG - Intronic
1138310308 16:56017899-56017921 AGGAGTCTGAGCAGCAACGGGGG + Intergenic
1139069750 16:63365694-63365716 TTGAATCTGCAGAGCAAGGGAGG - Intergenic
1140026107 16:71291673-71291695 TGTAATCTCAGCTACAAGGGAGG + Intergenic
1140060443 16:71564887-71564909 TAGAATCTGAGCTGCAGGTGAGG - Intronic
1141432311 16:83976684-83976706 TGAAATCTGAGCTGCGATGGGGG + Intronic
1141448846 16:84082899-84082921 TGGAAGCCGAGCAGCAGTGGCGG - Intronic
1141987713 16:87590772-87590794 TGGTATGGGGGCAGCAAGGGTGG + Intergenic
1142426596 16:90004920-90004942 TGGAAGCTCAGCAGGAAGGATGG + Exonic
1143494279 17:7302674-7302696 TGTAATCTCAGCTGCTAGGGAGG - Intergenic
1145908712 17:28530550-28530572 TGGAATCTGAGAAACCTGGGTGG - Intronic
1145952106 17:28826557-28826579 TGTAATCTGAGCTGCTTGGGAGG + Intronic
1146532199 17:33617762-33617784 TGGATTTTCAGCAGCAAAGGTGG - Intronic
1148200176 17:45744946-45744968 TGGAATCTAAGCTACTAGGGAGG + Intergenic
1148555667 17:48577388-48577410 TGGAATCTGAGCAGCAAGGGTGG - Intronic
1148610104 17:48959443-48959465 TTGATGCTGAGCAGCTAGGGAGG - Intronic
1150683482 17:67301705-67301727 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1151816195 17:76472622-76472644 TGGAATAGGAGCAGCAGGGCTGG + Intronic
1154470700 18:14697471-14697493 TGTAATCTGAGCACTATGGGAGG - Intergenic
1154473095 18:14723735-14723757 TGTAATCTCAGCACCATGGGAGG - Intergenic
1155135189 18:22984504-22984526 TGTAATCTGAGCACCTTGGGAGG - Intronic
1155523996 18:26697949-26697971 TGGATTCTGAGCAGGAGGGAAGG + Intergenic
1155680646 18:28482012-28482034 TGGAATCTGTTAAGTAAGGGAGG - Intergenic
1156814733 18:41296155-41296177 TGAATTCTGAGCAGCAATAGTGG - Intergenic
1157307560 18:46528303-46528325 AGGAGGCTGAGGAGCAAGGGCGG + Intronic
1158123779 18:54079893-54079915 TGGAGTCTGAGCATCCAGTGTGG + Intergenic
1160547356 18:79668527-79668549 CCACATCTGAGCAGCAAGGGAGG - Intergenic
1161571203 19:5031744-5031766 AGGAATCTGAGCAGGACGGCAGG - Intronic
1161788806 19:6345982-6346004 TGGAATCCCAGCAGCTTGGGAGG - Intergenic
1162387170 19:10366589-10366611 AGGAAATTGAGCAGAAAGGGAGG + Intronic
1163758469 19:19120539-19120561 TGCAATCTGAGCAGGAGGCGGGG - Intronic
1164906495 19:31972650-31972672 TGGAACGTGAGCAGGAAGGCAGG - Intergenic
1166540808 19:43604408-43604430 TGTAATCTCAGCAGCTTGGGAGG - Intronic
1166587496 19:43962822-43962844 TGGAATTTTAACAGCAAGAGAGG - Intronic
1166606158 19:44144662-44144684 TGGAATTTTAACAGCAAGAGTGG - Intronic
1166643609 19:44514713-44514735 TGTAATCTGAGCAGTTTGGGAGG - Intronic
1166924729 19:46259584-46259606 TGGCAGCTGAGCACCGAGGGCGG - Intergenic
1166951763 19:46433367-46433389 TGTAATCTCAGCTGCTAGGGAGG - Intergenic
1167119963 19:47511000-47511022 TGGCATCTGAGCACCAAGGCAGG + Intronic
1167765248 19:51478479-51478501 TGCACTCTGACCAGCAGGGGTGG - Intergenic
1167893569 19:52562254-52562276 TGAAATCTCAGCTGCATGGGAGG + Intronic
1168122245 19:54257978-54258000 TGTAATCTGAGCACCTAGGGAGG + Intronic
1168705041 19:58465703-58465725 TGGAATCTGAGCACTTTGGGTGG - Intergenic
925034614 2:676301-676323 TGGCATCTGAGCATCAGGTGGGG - Intronic
925865277 2:8221483-8221505 CAGAATCTGAACAGCAATGGAGG - Intergenic
926069202 2:9871735-9871757 AGGAATCTGATCAGCTCGGGGGG - Intronic
926253024 2:11166632-11166654 TGGAATCTCAGCACCTTGGGAGG + Intronic
927676158 2:25107650-25107672 TGGAATGAGGGAAGCAAGGGAGG - Intronic
927682347 2:25148220-25148242 TGGAACCTCAGCAGCCGGGGAGG + Intronic
928089502 2:28365471-28365493 TGGAATCAGAGCTGCCAGGAGGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928810441 2:35218315-35218337 AGGGATCTGAGCAGAAAGGTTGG - Intergenic
932307586 2:70714988-70715010 GGGAATTTCAGCAGCAATGGGGG - Intronic
932778100 2:74540567-74540589 TGGAACTTCAGCAGGAAGGGTGG - Intronic
932779356 2:74550196-74550218 TGGAGTCCGAGAAGCCAGGGAGG + Exonic
933101169 2:78259687-78259709 TTGAATATGAGCAGCAAAGATGG - Intergenic
933468773 2:82693095-82693117 TGTAATCTGAGCACTATGGGAGG + Intergenic
934747251 2:96767524-96767546 TGGAAGGTGGGCTGCAAGGGGGG - Intronic
935743408 2:106170697-106170719 TGGAATCTGTGCAGCAACGTGGG - Intronic
936116240 2:109705435-109705457 TGGAATATATGCAGCGAGGGTGG + Intergenic
937339705 2:121083385-121083407 TGTAATCTCAGCTGCTAGGGAGG - Intergenic
938967043 2:136397848-136397870 GGGAATCTGGGCAGAAAGGCAGG - Intergenic
939456674 2:142446141-142446163 TGCAAGCTGAGGAGCAAGGAAGG + Intergenic
939500928 2:142983077-142983099 TGGCATCAGAGCATCAAGGTAGG + Intronic
939726932 2:145732268-145732290 TGTAATCTCAGCTACAAGGGAGG + Intergenic
940712814 2:157182917-157182939 TGGAAAATGAGAAACAAGGGTGG - Intergenic
941582931 2:167321783-167321805 TGGAATAGGAGCTGAAAGGGTGG - Intergenic
942335426 2:174879889-174879911 TGAAATCTGAGAAGTATGGGGGG + Intronic
942793712 2:179791876-179791898 TGTAATCTCAGCTGCTAGGGAGG - Intronic
943076842 2:183206058-183206080 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
943652148 2:190468713-190468735 TGTAATCTGAGCACCCTGGGAGG - Intronic
944848507 2:203692736-203692758 TGGAATGTCAGCAACAAGGCAGG + Intergenic
946490206 2:220141740-220141762 TGTAATCTGAGCCACACGGGAGG - Intergenic
947040229 2:225910180-225910202 TGTAATCTCAGCAACTAGGGAGG + Intergenic
947886128 2:233573295-233573317 TGGGCTCTGAGCTACAAGGGTGG - Intergenic
1169079609 20:2788526-2788548 TGTAATCCCAGCAGCGAGGGAGG - Intergenic
1170461190 20:16577997-16578019 TGTAATCTCAGCAGCTTGGGAGG - Intergenic
1170803268 20:19607857-19607879 TGGGATGTGACCAGCAAAGGGGG - Intronic
1171312964 20:24160435-24160457 TGGAAACTGACCACCAAGGAGGG - Intergenic
1172110750 20:32543495-32543517 TGTAATCTCAGCAACTAGGGAGG + Intronic
1172922489 20:38496977-38496999 TTCAATGTGAGCAGCAAGGGTGG + Intronic
1173417449 20:42869384-42869406 TGGACACCGTGCAGCAAGGGTGG - Intronic
1173928245 20:46797090-46797112 TGGAGTCAGATCAGCAAAGGTGG - Intergenic
1173960294 20:47066081-47066103 TGTAATCTGAGCATTTAGGGAGG + Intronic
1174275591 20:49401538-49401560 TGTAATCTCAGCAGTCAGGGAGG - Intronic
1174566212 20:51466307-51466329 TGGAATCTCAGCACCTTGGGAGG - Intronic
1175174708 20:57104237-57104259 TGGAATGGGAGCAACAAGGCAGG - Intergenic
1175974056 20:62701602-62701624 TGGTGTGTGAGCAGGAAGGGTGG - Intergenic
1176803786 21:13460457-13460479 TGTAATCTGAGCACTATGGGAGG + Intergenic
1177953457 21:27567880-27567902 TGGAATATGAGAAGCAAGGAAGG + Intergenic
1178164687 21:29960412-29960434 TGGAATGTGAACAGAAATGGTGG + Intergenic
1183040090 22:35171496-35171518 TGGAATCTGAGCAGAAGTGAGGG + Intergenic
1183719188 22:39552517-39552539 AGGAATCTGGGCAGGAAGTGTGG - Intergenic
1183894819 22:40959858-40959880 TGTAATCTCAGCACCATGGGAGG + Intronic
1184675601 22:46041023-46041045 TAGAATCTGCTCAGCCAGGGAGG - Intergenic
1184808388 22:46811530-46811552 TGGAGTCTGAGTGGCGAGGGTGG + Intronic
949979220 3:9490202-9490224 TGGAAACTGAGCTTCAAGGCCGG + Intergenic
950553256 3:13680348-13680370 AGCAACCTGAGCAGCGAGGGTGG - Intergenic
951702649 3:25511716-25511738 TGGGATCTGACCAGCAACTGAGG - Intronic
951781215 3:26364764-26364786 TGTCTGCTGAGCAGCAAGGGAGG - Intergenic
952121207 3:30246430-30246452 TGGAAATTGAGCAGCAAAAGAGG - Intergenic
953055126 3:39381810-39381832 TGGAATCAGTGCAGCGGGGGTGG + Intergenic
955331716 3:58052646-58052668 TGTCATCTGAGCAGTCAGGGTGG + Intronic
955616401 3:60812282-60812304 GGGAATCTGAGCTGCTTGGGAGG - Intronic
955631104 3:60976361-60976383 TGGAATCTGAGCACTTTGGGAGG - Intronic
956307200 3:67838305-67838327 TGCAAGCTGAGGAGCAAGGAGGG - Intergenic
956730621 3:72193578-72193600 TGGAATGTGAGCAGCAGAGATGG + Intergenic
957712322 3:83877328-83877350 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
958778105 3:98509730-98509752 TGCAAGCTGAGGAGCAAGGAAGG + Intronic
959049421 3:101510729-101510751 TGTAATCTCAGCTGCTAGGGAGG + Intronic
959527060 3:107388991-107389013 TGGAGTCTGAGGTCCAAGGGTGG + Intergenic
959826810 3:110806950-110806972 TAGCATCTGGGCAGCAATGGTGG - Intergenic
960532900 3:118785325-118785347 TGGGCTGTCAGCAGCAAGGGAGG - Intergenic
960742390 3:120849517-120849539 TGGAATTTGAGAAGGAAGGTAGG - Intergenic
961463910 3:127070134-127070156 AGGGTTCTGAGCAGCAAGGATGG - Intergenic
962028316 3:131572301-131572323 TGGAAACTGACCAGAAAGAGTGG + Intronic
962428474 3:135297248-135297270 AGGAACCTGAGGCGCAAGGGAGG - Intergenic
963167508 3:142220507-142220529 TGTAATCTGAGCAGGCAGTGAGG - Intronic
963600429 3:147373568-147373590 AGGAGCCTTAGCAGCAAGGGTGG - Intergenic
963677462 3:148330550-148330572 GGGAAATTTAGCAGCAAGGGAGG - Intergenic
966173602 3:177111554-177111576 TGTAATCTCAGCAGTTAGGGTGG - Intronic
967144870 3:186598093-186598115 TGTAATCTCAGCAGCTTGGGAGG - Intergenic
967826771 3:193883359-193883381 TGGAATCCCAGCACCATGGGAGG + Intergenic
967906216 3:194502681-194502703 TGTAGTCTCAGCAGCTAGGGAGG - Intergenic
970122762 4:12775297-12775319 TGGAATCTAAGCTGCAAGGAAGG - Intergenic
970526371 4:16936642-16936664 TGTAATCTTAGCTGCTAGGGAGG + Intergenic
971923125 4:32969632-32969654 TGTAATCTGAGCAGTTTGGGAGG + Intergenic
974221012 4:58970896-58970918 TGCAAGCTGAGGAGCAAGGAGGG + Intergenic
974466683 4:62266113-62266135 TGTAATCTGAGCACTTAGGGAGG - Intergenic
976328062 4:83795470-83795492 TGGGAACTGAGCAGAAAGGAAGG + Intergenic
976563071 4:86523902-86523924 TGGAATCTGATCACCAATGTTGG + Intronic
977409813 4:96648271-96648293 TGTAATCACAGCAGTAAGGGAGG + Intergenic
977568877 4:98609855-98609877 AGGATTCTGAGCAGAAGGGGAGG + Intronic
977769907 4:100846106-100846128 TGTAATCCCAGCAGCATGGGAGG + Intronic
978058498 4:104305782-104305804 TGGAAACTCAGCGGAAAGGGTGG - Intergenic
978507673 4:109477580-109477602 TGTAATCTGAGCACCTTGGGAGG - Intronic
978784468 4:112594009-112594031 TGTAATCTTAGCACTAAGGGAGG - Intronic
979400145 4:120239159-120239181 AGAAATGTGAACAGCAAGGGAGG + Intergenic
980923084 4:139106863-139106885 TGTAATCTGAGCCGCTTGGGAGG - Intronic
982132862 4:152246247-152246269 TGGATGCTGGGCAGCAAGGCTGG + Intergenic
983027727 4:162757937-162757959 TGCAAGCTGAGGAGCAAGGAGGG - Intergenic
984681301 4:182612148-182612170 TGTAATCTGAGCTACAGGGGAGG + Intronic
984971480 4:185195230-185195252 TGTAATCTCAGCAGTTAGGGAGG + Intronic
985088424 4:186339367-186339389 TGGAAGCTGAGTGGCAAGAGGGG + Intergenic
985885520 5:2674687-2674709 TGAAATGTGAGCAGCACTGGGGG - Intergenic
987150483 5:15034579-15034601 TGGAATGTGAGCAGGACAGGAGG + Intergenic
989071212 5:37513627-37513649 TGCAAGCTGAGGAGCAAGGAAGG + Intronic
989225976 5:39028774-39028796 TGTAATCCCAGCAGCTAGGGAGG + Intronic
989389378 5:40884679-40884701 TGTAATCTGAGCTACTAGGGAGG - Intergenic
990889405 5:60632376-60632398 TGCAAACTGAGCAGCAAGCCAGG + Intronic
990993473 5:61707926-61707948 TGGACTCTGACCAGGAAGTGGGG + Intronic
991126307 5:63073452-63073474 TGGGAGGTGAGCAGGAAGGGAGG - Intergenic
993717209 5:91287455-91287477 AGGAAGCTGAGGAGCAAGGATGG + Intergenic
993963863 5:94336111-94336133 TGTAATCTGAGCACTTAGGGAGG + Intronic
997519764 5:134515348-134515370 TGTAATCTCAGCACCATGGGAGG + Intergenic
997835318 5:137187293-137187315 TGGAAACAGAGCAGCAAGCTGGG + Intronic
1001717289 5:173826605-173826627 TTAACTCTGAGCAGCTAGGGAGG + Intergenic
1002870234 6:1160468-1160490 TAGAACCTGTGCTGCAAGGGAGG + Intergenic
1003168455 6:3701584-3701606 GGGAATCTGAGCTGCTAAGGTGG + Intergenic
1003445930 6:6184385-6184407 AGAAATCTGAGCCGCAAGTGTGG - Intronic
1004280394 6:14275394-14275416 TGGAAGCAGAGCCCCAAGGGTGG - Intergenic
1004393456 6:15228257-15228279 TGTAATCTGAGCACCCTGGGAGG + Intergenic
1004845515 6:19637614-19637636 AGGAAGGTGAGCAGCAAGGATGG - Intergenic
1006027985 6:31159464-31159486 TGGAAGCAGGGCAGCATGGGCGG - Exonic
1006038041 6:31229473-31229495 TGGAAACAGAGCAGGAAGGAAGG + Intergenic
1006068450 6:31479233-31479255 TGGAATATTAGCAGCCAGGAAGG - Intergenic
1007776474 6:44227041-44227063 TAGAGTCTGAGCAGGCAGGGGGG + Intronic
1008475715 6:51933760-51933782 TGGAATGTGAGCAGAACTGGGGG - Intronic
1010617626 6:78031739-78031761 TGCAAGCTGAGGAGCAAGGAAGG + Intergenic
1012206358 6:96465569-96465591 TGAAATGTGAGCAGGAAAGGTGG - Intergenic
1012924660 6:105255080-105255102 TGGAATCTGTGCACAAATGGAGG - Intergenic
1013248830 6:108314198-108314220 TGCAGTCTGGGCAACAAGGGCGG + Intronic
1014665812 6:124235851-124235873 TGGAATCTGAGCACTTTGGGAGG - Intronic
1014879790 6:126709562-126709584 TGCAAGCTGAGGAGCAAGGAAGG + Intergenic
1015311364 6:131770718-131770740 AGGAAACTGAGCAGTGAGGGTGG + Intergenic
1015352124 6:132232651-132232673 TGGGATCTGCACATCAAGGGAGG + Intergenic
1018894495 6:168004241-168004263 GGGGAGCTGAACAGCAAGGGAGG + Intronic
1018942886 6:168320949-168320971 TGGAATCACAGCAGCCAGCGGGG + Intergenic
1019454652 7:1120411-1120433 TGTAATCTCAGCTGCTAGGGAGG - Intronic
1020950392 7:14668762-14668784 TGGAATTTGAGCTGGAAGTGAGG - Intronic
1021852661 7:24823735-24823757 TCGAATCTTAGCATCAAAGGTGG + Intronic
1023055166 7:36285039-36285061 TGGCATCTGAGCAGGAGAGGGGG + Intronic
1023617308 7:42033018-42033040 AGGAAGCTGAGCAGAAAGGAAGG + Intronic
1023834520 7:44060424-44060446 TGGACTCTGAGCAGGGAGGTGGG + Intronic
1024577846 7:50779509-50779531 TGAAATCTGTGTAGGAAGGGAGG - Intronic
1024684013 7:51725413-51725435 TGGAATCTGAGCCCCAAGGAGGG - Intergenic
1026868652 7:73837683-73837705 TGTAATCCCAGCTGCAAGGGAGG - Intronic
1027130348 7:75586068-75586090 TGTAATCTGAGCATTATGGGAGG - Intronic
1028047994 7:86147842-86147864 TGTAATCTGAGCACTATGGGAGG - Intergenic
1028130707 7:87169335-87169357 TGTAATCTCAGCTGCTAGGGAGG + Intronic
1028554188 7:92104705-92104727 TGGAATATCAGAAGCAAGGAGGG - Intronic
1028895862 7:96040841-96040863 TGGAATCCCAGCTGCTAGGGAGG - Intronic
1029414367 7:100433728-100433750 TGGCACCTGCGCAGCAAGGCTGG + Exonic
1031009557 7:116511711-116511733 TGGAATCTGAACAGGAGTGGAGG + Intergenic
1031216643 7:118901089-118901111 TGGAATATGATGAGGAAGGGAGG - Intergenic
1031998958 7:128252344-128252366 TGGAATCTCAGCAGGCAGAGGGG - Intronic
1032137621 7:129295230-129295252 TTGAAGCTGAGCAGCCAGGCTGG + Intronic
1032364272 7:131284824-131284846 AGGAATCTGAGAAGCAAGTGAGG + Intronic
1032589033 7:133175373-133175395 TGGAAGCTGAGCATGCAGGGAGG - Intergenic
1034633449 7:152548742-152548764 TGTAATCCCAGCTGCAAGGGAGG - Intergenic
1036414025 8:8530077-8530099 TGGAAGCTCAGCAGGCAGGGAGG + Intergenic
1037408429 8:18568431-18568453 AGGAGTCTAAGAAGCAAGGGGGG + Intronic
1037880953 8:22573137-22573159 TGGGATCAGATCAGGAAGGGTGG - Intronic
1038044197 8:23752461-23752483 TGGAAGCTGAGCTGCGGGGGAGG - Intergenic
1038700819 8:29847823-29847845 TGGAAACTGAGCAGGAAGGCTGG - Intergenic
1041795656 8:61744996-61745018 TTGGAGCTGAGCAGTAAGGGAGG - Intergenic
1042135005 8:65624375-65624397 TGTAATCTCAGCTGCTAGGGAGG + Intronic
1043780890 8:84333835-84333857 TAGAATTTGAACAGCAGGGGTGG + Intronic
1044293986 8:90506089-90506111 TGCAAGCTGAGGAGCAAGGAAGG - Intergenic
1044639533 8:94363940-94363962 AGCAATCTGAGCAGAAAGGGTGG + Intergenic
1045334693 8:101189127-101189149 TGGAAGCTGAGGGGCAAGGAAGG - Intronic
1045353946 8:101368436-101368458 TGTAATCTGAGCACCTTGGGAGG - Intergenic
1045446758 8:102274295-102274317 TGGAATCTGAGGTGGAAGGATGG - Intronic
1045569541 8:103354788-103354810 TGTAATCTGAGCAGTTTGGGAGG + Intergenic
1046817004 8:118596222-118596244 TGGAATCTGAGCAGCGAACAAGG - Intronic
1047452703 8:124980036-124980058 TGTAATCTCAGCAGCTTGGGAGG - Intergenic
1047689082 8:127332173-127332195 TGCAATCTGAGAAGGAAGGTTGG - Intergenic
1048255073 8:132899476-132899498 TGGAAGCTGAGCAGAGTGGGTGG - Intronic
1048941640 8:139405327-139405349 TGGAATCAGAGCCCCAGGGGTGG - Intergenic
1049418902 8:142508212-142508234 TGGTGGCTGTGCAGCAAGGGAGG - Intronic
1049757147 8:144315773-144315795 TGGAACCTGGGCAGCCAGGTGGG - Exonic
1050008824 9:1164058-1164080 TGGAATCTGGGGAGGGAGGGAGG - Intergenic
1053430845 9:38040876-38040898 TGGAAGATGAGTGGCAAGGGAGG + Intronic
1053464476 9:38295324-38295346 TGGAGTCCCAGGAGCAAGGGAGG - Intergenic
1053800660 9:41762480-41762502 GGGACTCTGGGCAGCAGGGGAGG - Intergenic
1054189091 9:61974632-61974654 GGGACTCTGGGCAGCAGGGGAGG - Intergenic
1054811045 9:69434188-69434210 GGGACTCTGTGCAGCCAGGGTGG + Intronic
1055057095 9:72034029-72034051 TGTAATCTGAGCACCTTGGGAGG - Intergenic
1056665932 9:88580725-88580747 TGAAATCTGAAGAGCATGGGTGG - Intronic
1056827675 9:89887998-89888020 TGGAATCTGGGAAGGAAGGAAGG + Intergenic
1057818701 9:98315048-98315070 TGGAATGTCAGCAGCACAGGGGG - Intronic
1058800688 9:108542071-108542093 TGGAATCTCAGCCTGAAGGGGGG - Intergenic
1058996602 9:110304889-110304911 TGTAATCTGAGCACCTCGGGAGG + Intronic
1059488476 9:114646064-114646086 TGTAATCCCAGCAGCATGGGAGG - Intronic
1060344362 9:122803500-122803522 TGAAATCTGAGCAGAATGGCTGG - Intronic
1060556989 9:124513057-124513079 TGGAATGTGGGGAGCAAGGCTGG - Intergenic
1060655014 9:125365758-125365780 TGTAATCTGAGCAACCAGGGAGG - Intronic
1061625370 9:131838133-131838155 TGGAATGGGAGGAGCAAGGCAGG + Intergenic
1203693807 Un_GL000214v1:74758-74780 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1203558260 Un_KI270744v1:23130-23152 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1203642466 Un_KI270751v1:29305-29327 TGTAATCTCAGCTGCTAGGGAGG - Intergenic
1185651795 X:1653274-1653296 TGTAATCTCAGCTGCTAGGGAGG + Intergenic
1186361899 X:8851088-8851110 TGTAGTCTGAGCAGAATGGGTGG + Intergenic
1186724653 X:12344368-12344390 TGGAATTTGAGCAGTACTGGAGG - Intronic
1187320263 X:18231400-18231422 TGGAATCTCAGCTGCTTGGGAGG + Intergenic
1187534162 X:20123064-20123086 TGTAATCTGAGCTGCTTGGGAGG - Intergenic
1188334108 X:28907374-28907396 TGTAATCTCAGCTGCTAGGGAGG - Intronic
1188524028 X:31070804-31070826 TGGATTCTGAGTAGCAAGTGGGG - Intergenic
1189224716 X:39403123-39403145 TGGAGTCTGAGCAGAGAGGTGGG + Intergenic
1193636840 X:83961441-83961463 TGGGAACTCAGCAGGAAGGGTGG + Intergenic
1194744826 X:97617027-97617049 TGAAACCTGAGCAGCCAGGAAGG + Intergenic
1197462417 X:126758613-126758635 TGTAATCTGAGCTACTAGGGAGG + Intergenic
1198747483 X:139905003-139905025 TGGAATAAGAGTAGCAAGAGTGG + Intronic
1199611721 X:149622807-149622829 TGGAATCTGGGCAACAAGTTGGG + Intronic
1200129822 X:153835395-153835417 TGTAATCCCAGCAGCTAGGGAGG - Intergenic
1200376258 X:155783631-155783653 TGTAATCTGGGTAACAAGGGAGG - Intergenic
1202131152 Y:21611981-21612003 TGTAATCTGAGCTACTAGGGAGG + Intergenic
1202591301 Y:26486531-26486553 TGGAATCTGTTCAGCAATGCTGG - Intergenic