ID: 1148556606

View in Genome Browser
Species Human (GRCh38)
Location 17:48582261-48582283
Sequence GCCCAGAGGGGGCGCGGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 531}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148556589_1148556606 23 Left 1148556589 17:48582215-48582237 CCCAGCCGGCCTGCGCACCGGCG 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531
1148556593_1148556606 18 Left 1148556593 17:48582220-48582242 CCGGCCTGCGCACCGGCGGCGGC 0: 1
1: 0
2: 4
3: 17
4: 171
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531
1148556588_1148556606 24 Left 1148556588 17:48582214-48582236 CCCCAGCCGGCCTGCGCACCGGC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531
1148556595_1148556606 14 Left 1148556595 17:48582224-48582246 CCTGCGCACCGGCGGCGGCGGCG 0: 1
1: 3
2: 20
3: 150
4: 661
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531
1148556590_1148556606 22 Left 1148556590 17:48582216-48582238 CCAGCCGGCCTGCGCACCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531
1148556598_1148556606 6 Left 1148556598 17:48582232-48582254 CCGGCGGCGGCGGCGCGGAGGAG 0: 1
1: 0
2: 7
3: 43
4: 362
Right 1148556606 17:48582261-48582283 GCCCAGAGGGGGCGCGGGCGAGG 0: 1
1: 0
2: 2
3: 42
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148556606 Original CRISPR GCCCAGAGGGGGCGCGGGCG AGG Intronic