ID: 1148557816

View in Genome Browser
Species Human (GRCh38)
Location 17:48589023-48589045
Sequence CCCCTCCAATTTAACACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148557816_1148557821 -9 Left 1148557816 17:48589023-48589045 CCACGGGTGTTAAATTGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148557821 17:48589037-48589059 TTGGAGGGGGGTCAATTTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 211
1148557816_1148557823 -7 Left 1148557816 17:48589023-48589045 CCACGGGTGTTAAATTGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148557823 17:48589039-48589061 GGAGGGGGGTCAATTTGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 133
1148557816_1148557825 18 Left 1148557816 17:48589023-48589045 CCACGGGTGTTAAATTGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148557825 17:48589064-48589086 GAAGCCTCTGACTTTTAGAAGGG 0: 1
1: 0
2: 2
3: 20
4: 199
1148557816_1148557824 17 Left 1148557816 17:48589023-48589045 CCACGGGTGTTAAATTGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148557824 17:48589063-48589085 AGAAGCCTCTGACTTTTAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 323
1148557816_1148557822 -8 Left 1148557816 17:48589023-48589045 CCACGGGTGTTAAATTGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1148557822 17:48589038-48589060 TGGAGGGGGGTCAATTTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148557816 Original CRISPR CCCCTCCAATTTAACACCCG TGG (reversed) Intronic
907450966 1:54545631-54545653 GCCCTCCCATTTTACACCCGGGG - Intronic
910672677 1:89788961-89788983 TCCCTCCATTTTCAAACCCGAGG + Intronic
913557863 1:119987014-119987036 CCCCTCCATTCTGACACCTGTGG + Exonic
914348637 1:146821078-146821100 CCCCTGCAATTGAAGAACCGTGG + Intergenic
921270976 1:213469584-213469606 CTCCTCCAATGTCACACCCCAGG + Intergenic
924186228 1:241494134-241494156 CCACTCCAATTTAACCTCCATGG + Intergenic
1064491374 10:15860573-15860595 CGCCTCCAATTTCACTTCCGGGG - Intergenic
1078267607 11:9766608-9766630 CCTCCCCATTTTAACAGCCGAGG - Intergenic
1079947440 11:26761767-26761789 CTCCTCCAATTTATCACTCAGGG + Intergenic
1087982283 11:104630335-104630357 CCCATCCACTTGATCACCCGTGG - Intergenic
1096624131 12:52883117-52883139 CCCCTCGGATTTCTCACCCGGGG + Intergenic
1102141032 12:110614854-110614876 CACCTCCAATTCAACACAGGAGG - Intronic
1102914194 12:116740608-116740630 CCCCTCCCATGTAACACATGGGG + Intronic
1108616285 13:52136125-52136147 CACCTCCAGTTTAACAGCAGAGG - Exonic
1114481770 14:23040246-23040268 CCCCACCACTCTAACACCCCTGG + Intergenic
1128564520 15:68691805-68691827 CCCCTCCAGTGTATCGCCCGTGG + Intronic
1129355519 15:74988230-74988252 GGCCTCCAATTGAACACCTGGGG - Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1139985401 16:70894470-70894492 CCCCTGCAATTGAAGAACCGTGG - Exonic
1142188751 16:88707349-88707371 CGCCTCCACTTCAACACCAGGGG - Intronic
1148557816 17:48589023-48589045 CCCCTCCAATTTAACACCCGTGG - Intronic
1149967344 17:61178791-61178813 ACCCCCAAATTTAACACCCTGGG + Intronic
1168598302 19:57696613-57696635 CCCCTGCAAGTTACCACCCTGGG - Intronic
940347727 2:152644814-152644836 CCCCCCCAATTTAAAAACAGTGG - Intronic
946412455 2:219522125-219522147 CCCCTCCAACCCAACACCCACGG - Intronic
1173852796 20:46229294-46229316 CCCCCCCAATTTTACAGCTGAGG + Intronic
1184999748 22:48238172-48238194 CCCCTCCACTCTAACACTGGGGG + Intergenic
1185406627 22:50655906-50655928 CCCCTCCAATCCAGGACCCGTGG - Intergenic
957896564 3:86427520-86427542 CCGCTCCCATTTAAAACCTGAGG + Intergenic
966245575 3:177804495-177804517 CTCCACCAACTTAACACCCCGGG - Intergenic
966510394 3:180755849-180755871 ACCCACCAATTTTACACCCTTGG - Intronic
970225066 4:13849377-13849399 CCCCTCCACTTTATCTCCAGAGG + Intergenic
970886299 4:20991138-20991160 CCCCTCCAATGTAAGAACCCTGG - Intronic
980667596 4:135959452-135959474 CCCCTCCAATTTAACATATTTGG - Intergenic
994941245 5:106326940-106326962 GCTCTCCTTTTTAACACCCGTGG + Intergenic
995379015 5:111512059-111512081 CCTCTCCCATTTAACAGCTGAGG + Intronic
995777026 5:115734669-115734691 CCCCTTCAATTTTGCACCCTTGG + Intergenic
1003066116 6:2904348-2904370 CTCCTTCAATTTGACACCCTAGG + Intergenic
1003086067 6:3062880-3062902 CTCCTTCAATTTGACACCCTAGG - Intergenic
1010274076 6:73948850-73948872 CCCCTGGAGTTTAACACCAGAGG - Intergenic
1010946323 6:81977214-81977236 CTCCTCCAATTTAACACTGCAGG + Intergenic
1011001336 6:82591445-82591467 CCCCTACCATTTACCACCAGTGG + Intergenic
1015541252 6:134316391-134316413 CCCATCCTATTTAATACCCTAGG - Intronic
1026902611 7:74045350-74045372 CCCACCCCATTTCACACCCGGGG - Intronic
1028902330 7:96115528-96115550 ACCTTCCAATTTTACACCCGTGG + Intergenic
1044187967 8:89279146-89279168 CTCCTGAAATTTAACACCCTGGG - Intergenic
1050108193 9:2187270-2187292 CCCCTTAAATTTTACACCCAAGG + Intronic
1203781472 EBV:103400-103422 CACCTTCAAGTTAACACCCGTGG + Intergenic
1186441290 X:9588969-9588991 CCCCTTCAATTTTGCACCAGAGG + Intronic
1187426086 X:19178567-19178589 CCCCTTCAATTTTGCACCAGAGG - Intergenic
1187663843 X:21581574-21581596 CACTTCCACTTTAACACCCAGGG - Intronic