ID: 1148559406

View in Genome Browser
Species Human (GRCh38)
Location 17:48597379-48597401
Sequence AACCCTACCAGGGCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 293}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148559401_1148559406 -7 Left 1148559401 17:48597363-48597385 CCGTCTTTGGTTGGGGAACCCTA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293
1148559394_1148559406 24 Left 1148559394 17:48597332-48597354 CCTTGCATGACGCACTCCGTTTT 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293
1148559396_1148559406 8 Left 1148559396 17:48597348-48597370 CCGTTTTTAATGGAGCCGTCTTT 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293
1148559393_1148559406 25 Left 1148559393 17:48597331-48597353 CCCTTGCATGACGCACTCCGTTT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293
1148559392_1148559406 26 Left 1148559392 17:48597330-48597352 CCCCTTGCATGACGCACTCCGTT 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293
1148559391_1148559406 27 Left 1148559391 17:48597329-48597351 CCCCCTTGCATGACGCACTCCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148559406 Original CRISPR AACCCTACCAGGGCTGGGAG AGG Intronic
900982262 1:6052745-6052767 AACTCTACAAGGACTGGGTGGGG - Intronic
901010633 1:6199754-6199776 AAACCCTCCAGGCCTGGGAGAGG - Intronic
901635622 1:10668907-10668929 AACCTTACCTGGCCTGGAAGAGG + Intronic
901706399 1:11076703-11076725 AAACCCAGCAGTGCTGGGAGAGG - Intronic
902556720 1:17251034-17251056 AAACCCCCCAGGGGTGGGAGTGG + Intronic
903252940 1:22069755-22069777 ACCTCTACCAAGGCTGGGTGTGG - Intronic
903517798 1:23924053-23924075 AACCCTTGCAAGGATGGGAGTGG - Intergenic
904489125 1:30847501-30847523 GTCCCTTCCTGGGCTGGGAGGGG + Intergenic
904553443 1:31340605-31340627 AACCCTCCAAGGGCCGGGCGCGG - Intronic
904832636 1:33314957-33314979 AAACATAATAGGGCTGGGAGGGG + Intronic
905266912 1:36760626-36760648 AACCATAAGAGGCCTGGGAGGGG + Intergenic
912804440 1:112744150-112744172 AACCCTGGTTGGGCTGGGAGGGG + Intergenic
916599990 1:166283349-166283371 GATCCTAGCAGGGCTGAGAGAGG - Intergenic
916738990 1:167631776-167631798 AACACAACCAGGGCCAGGAGTGG - Intronic
920661863 1:207922363-207922385 AACTCTACCAGGGCCAGGTGGGG - Intergenic
924425254 1:243944450-243944472 AACCCTAACAGAGGAGGGAGTGG + Intergenic
1064175029 10:13067190-13067212 ACCCCAACCCTGGCTGGGAGGGG - Intronic
1064825446 10:19393743-19393765 AACCCCATCAGGGCCGGGCGCGG - Intronic
1065708986 10:28497231-28497253 AATCCAATCAGGGCTGGGTGTGG + Intergenic
1065736268 10:28755456-28755478 TACCCTACCAGGGCTGGCAGTGG + Intergenic
1065762657 10:28996918-28996940 AAGCATCCCAGGGCTGGGTGTGG - Intergenic
1067106972 10:43373059-43373081 TCCCCTGCCAGGGCTGGCAGGGG + Intronic
1067461743 10:46463324-46463346 AAGGCTACCAGGGCAGGGAGGGG - Intronic
1067625451 10:47921277-47921299 AAGGCTACCAGGGCAGGGAGGGG + Intergenic
1067847841 10:49737529-49737551 GACCCTAGCAGGGCTGGTCGAGG - Intronic
1069604678 10:69731856-69731878 CACCCTGCCAGGAATGGGAGTGG + Intergenic
1070438212 10:76414454-76414476 AACCCTACAAGTGCTGGGCCTGG + Intronic
1070900669 10:80026344-80026366 AACAGAACCAGGGCTGGGCGTGG + Intergenic
1070902882 10:80045939-80045961 AACAGAACCAGGGCTGGGCGTGG - Intergenic
1072808734 10:98443740-98443762 AACAGTTCCAGGGCTGGGCGCGG + Intronic
1073362440 10:102910570-102910592 AACGATAACAGGGCTGGGTGTGG - Intergenic
1074603783 10:114940409-114940431 AACCTTCCCAAGGCCGGGAGTGG - Intronic
1074774145 10:116754053-116754075 ACCCCTGCCAGGGTGGGGAGAGG - Intergenic
1074976768 10:118587468-118587490 CACCCCACCAGGGCTGGGGCAGG - Intergenic
1075190148 10:120299749-120299771 AACCATGGCAGGGATGGGAGGGG + Intergenic
1075557797 10:123445833-123445855 ATGCCTTCCAGGGCTAGGAGAGG + Intergenic
1075674938 10:124289808-124289830 GACCCTGCCTGGGCTGGGACAGG - Intergenic
1076094465 10:127720153-127720175 GCCACTACCAGGGGTGGGAGGGG - Intergenic
1076595166 10:131620582-131620604 CACCCTCCCAGGGCTCAGAGAGG - Intergenic
1076856836 10:133120605-133120627 AACCCTATGATGGCTGAGAGAGG - Intronic
1077011734 11:381803-381825 ACTCCCACCGGGGCTGGGAGGGG - Exonic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077457756 11:2691155-2691177 ACCCCTCCCAAGGCTGTGAGAGG - Intronic
1077504623 11:2924326-2924348 CCCCCTCACAGGGCTGGGAGGGG - Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1079488210 11:20958125-20958147 AACCCCAACAAGGCTGGGTGTGG + Intronic
1081308511 11:41542548-41542570 TACCCTCCCAGGGATGGGTGAGG - Intergenic
1083304612 11:61755914-61755936 AGCCCCACCAGGGCTGGAGGAGG + Intronic
1083366581 11:62145120-62145142 AGCCCCACCAAGGCTGGGATGGG - Intronic
1083869497 11:65478052-65478074 AACACTACCAAGGCAGGGCGCGG + Intergenic
1086316962 11:85605686-85605708 AATGCTATCACGGCTGGGAGCGG + Intronic
1089063759 11:115646435-115646457 AACCCTCCGAGGACTGGGACTGG - Intergenic
1089278974 11:117359232-117359254 AACCCTGCCCAGGCTGGGCGTGG - Intronic
1089685366 11:120143311-120143333 TACCCTACCTGGGAGGGGAGGGG + Intronic
1091665560 12:2416119-2416141 AAAACAACCAGGGCTGAGAGAGG - Intronic
1092234429 12:6797327-6797349 AACCCTACAAGGCCTCTGAGTGG - Intronic
1096540877 12:52306301-52306323 AACCCTGGCAGGGCTGGGAAAGG - Intronic
1097084231 12:56455357-56455379 ATCCCTGCATGGGCTGGGAGTGG + Intronic
1097308390 12:58093616-58093638 ACCCCTCCTGGGGCTGGGAGAGG - Intergenic
1101681205 12:106967549-106967571 AAAACAATCAGGGCTGGGAGTGG - Intronic
1101750430 12:107578988-107579010 AACTCCACCAGGGCAGGGAATGG - Intronic
1101968843 12:109298651-109298673 AACCTTAGAAGGGCTGGGCGTGG - Intronic
1104873430 12:132016660-132016682 AACCCAACCAAGGCCGGGTGCGG - Intronic
1113766906 13:112887610-112887632 AATTCTGCCAGGGCTGGGAGTGG - Intergenic
1114671231 14:24412149-24412171 CACCCAACCAGGCCTGGGAAGGG + Intronic
1115567104 14:34634337-34634359 AACCCTGCCCAGGCTGGGCGCGG + Intergenic
1115649327 14:35391623-35391645 AACCATCCCAGGGCTGGGTGTGG + Intergenic
1118290806 14:64520291-64520313 AACCTTATTAGGGCTGGGTGTGG - Intronic
1118330048 14:64807925-64807947 AACCCTGCCAGTGCAGGAAGGGG + Intronic
1121046865 14:90794514-90794536 TACCCAGCCAGGGCTGGGTGCGG - Intronic
1121539184 14:94712272-94712294 AACTGTACCACGGCTGGGTGCGG + Intergenic
1122489389 14:102103511-102103533 AACCCTATCTCGGCTGGGTGTGG + Intronic
1123628655 15:22245474-22245496 CACCATACCCGGCCTGGGAGTGG - Intergenic
1123989084 15:25670010-25670032 ATCCCTGTCAGGGCTGGGGGAGG + Intergenic
1125665031 15:41423657-41423679 AAAGCTCCCAGGGCTGGGCGTGG - Intronic
1126021664 15:44408037-44408059 AGCGCTACCATGGCTGGGTGTGG - Intronic
1127242843 15:57137270-57137292 AACACTGCCAGGGCCGGGCGTGG - Intronic
1127580102 15:60330569-60330591 AACACTACTGGGGCTGGGCGCGG + Intergenic
1128030945 15:64479626-64479648 AAAGTTACCAGGGCTGGGTGTGG + Intronic
1129228304 15:74182457-74182479 AGCCCTGCCAGGGGCGGGAGTGG + Exonic
1129350884 15:74955483-74955505 AACTGTCCCAGGGCGGGGAGCGG + Exonic
1129713455 15:77833329-77833351 CACACTGCCAGGGCTGAGAGTGG + Intergenic
1130653166 15:85773740-85773762 GACTGGACCAGGGCTGGGAGTGG + Intronic
1131278508 15:91002332-91002354 TAACCAAACAGGGCTGGGAGCGG + Intronic
1131824495 15:96307346-96307368 AATGTAACCAGGGCTGGGAGTGG - Intergenic
1131909931 15:97187235-97187257 AACCCTAAATGGGCTGGGCGCGG - Intergenic
1132827994 16:1914414-1914436 AACCAGGCCAGTGCTGGGAGGGG + Intronic
1133099883 16:3472721-3472743 AAACCAACCAGGGCCAGGAGCGG - Intronic
1133115173 16:3574422-3574444 GACCCGAGCGGGGCTGGGAGAGG + Intronic
1134402306 16:13920878-13920900 AACACTAAGAGGGATGGGAGGGG + Intronic
1134818983 16:17230238-17230260 AAACCCACCAGGGCTGCGAGAGG + Intronic
1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG + Intronic
1135990790 16:27217508-27217530 GTCCCTCCCAGGGCTGTGAGGGG - Intronic
1136585618 16:31182525-31182547 AGCCCTGCCCGGGCTGGGTGGGG - Exonic
1137334416 16:47533707-47533729 AAGCCTGCGAGGGCAGGGAGGGG + Intronic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1138319816 16:56102402-56102424 AGCCCTGCCAGGGGTGGGGGTGG + Intergenic
1138570689 16:57870191-57870213 AGCCCTTCCAGGGCTGGCAGAGG + Intergenic
1139391159 16:66606700-66606722 AACTCTACCTGGGCCGGGCGTGG + Intronic
1140211631 16:72975149-72975171 AACCCTATCAGGGCCAGGTGTGG + Intronic
1141666550 16:85468610-85468632 GGCCCTACGAGGGCTGGGGGTGG - Intergenic
1141945187 16:87304773-87304795 CACTCTGCCACGGCTGGGAGCGG - Intronic
1142220024 16:88849712-88849734 AACCATCTCAGGGCTGGGCGTGG - Intronic
1142594695 17:1023732-1023754 AACATTAACAGGGCTGGGCGCGG + Intronic
1142718966 17:1763601-1763623 AACCCTACAAGGGCAGTGAGAGG - Intronic
1143230288 17:5348267-5348289 AAGCCTATCTGGGCTGGGCGTGG - Intronic
1145834049 17:27940360-27940382 AACCTTACCTGGGCCGGGAAGGG + Intergenic
1146042940 17:29474130-29474152 AACTCTACAAAGGCTGAGAGAGG - Intronic
1146328740 17:31910014-31910036 AACCCTTTCATGGCTGGGTGCGG + Intergenic
1146694465 17:34898112-34898134 CTCCCCACCAGGACTGGGAGAGG + Intergenic
1147140810 17:38459684-38459706 AACCTGCCCAGGGCTGGGAGGGG + Intronic
1147330730 17:39697644-39697666 GACCCTAGCACGGCTGGGTGCGG - Intronic
1148383700 17:47219674-47219696 ACCCATTCCAGGGCTGGGACTGG - Intronic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1148587385 17:48790682-48790704 ACACCTACAAGGGCTGGGAATGG + Intronic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1150682539 17:67294985-67295007 AACCCATCCATGGCGGGGAGGGG - Intergenic
1151632396 17:75319728-75319750 AAGCCCACCTGGGCTGGGCGCGG - Exonic
1152238701 17:79151198-79151220 AGCCCTCCCAGGGCAGGGGGTGG - Intronic
1152432210 17:80254779-80254801 CCCCCTGCCAGGGCTGGAAGAGG + Intergenic
1152573396 17:81130168-81130190 AGCCCCAACAGGGCTGGCAGGGG + Intronic
1152585074 17:81185650-81185672 AACCCCTCGAGGGCTGGGTGTGG + Intergenic
1152715586 17:81899010-81899032 GGTCCTCCCAGGGCTGGGAGTGG + Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1154202878 18:12311182-12311204 AACCCAGCTAGGGATGGGAGGGG - Intronic
1155621431 18:27784842-27784864 AAGCATAGCAGGGCTAGGAGGGG + Intergenic
1156453921 18:37282208-37282230 TACACTCCCAGGGGTGGGAGTGG - Intronic
1157663478 18:49466121-49466143 AACCAAACCAGGGCTAGGCGCGG + Intergenic
1158019720 18:52827129-52827151 AACCCAGCCAGGGCCTGGAGGGG + Intronic
1159354212 18:67316236-67316258 ATACCTACCAGGGAAGGGAGAGG + Intergenic
1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG + Intronic
1160877187 19:1302194-1302216 AGCCCACCTAGGGCTGGGAGGGG + Intergenic
1160946663 19:1646974-1646996 CCCCCTACCAGGGCTGGGTATGG + Intronic
1161031370 19:2059311-2059333 AACCCTACGGGGGCGGGGGGCGG + Intergenic
1161270735 19:3387976-3387998 CACCGTGCCAGGGCTGGGCGGGG + Intronic
1161315049 19:3613793-3613815 AACCATCCCATGGCAGGGAGAGG + Intronic
1162054777 19:8056025-8056047 AACCCTTCCAGGCCCGGCAGAGG - Intronic
1162320046 19:9966389-9966411 ACCCCAACCAGGGCTGCGCGCGG - Exonic
1162352452 19:10158809-10158831 ACCATTACCAGGGCTCGGAGGGG - Intronic
1162394633 19:10409820-10409842 AACACAAGCAGGGCTGGGAGCGG + Intronic
1162405636 19:10471582-10471604 CAGCCTAACAGGGCTGGGTGTGG - Intergenic
1163102645 19:15107556-15107578 AGCCCCACCCGGCCTGGGAGCGG + Intronic
1163276803 19:16289865-16289887 AACCCTACCTGGGTTGGGGGTGG - Intergenic
1163286368 19:16350806-16350828 AAACAAACCAGGGCTGGGTGCGG + Intergenic
1163845588 19:19636699-19636721 ATCCCTACCTGGGCTGGAAGTGG + Exonic
1165151622 19:33763970-33763992 CACCCAGCCAGGGCTGGGGGTGG + Intronic
1165308327 19:35015732-35015754 CACACTACAAGGCCTGGGAGTGG + Intronic
1165665019 19:37620996-37621018 AACCCTGACTGGGCTGGGTGTGG - Intronic
1166701714 19:44886042-44886064 ACCCACCCCAGGGCTGGGAGGGG + Intronic
1166851925 19:45765353-45765375 AGCACCACCAGGGCTTGGAGAGG + Exonic
1167290848 19:48624562-48624584 AACCCAGCCAGGCCTGGGACTGG + Intronic
1167702830 19:51060518-51060540 CAGCCTGCCAGGGCTGAGAGTGG + Exonic
1168702902 19:58452075-58452097 AACCCCCCCAGGGCAGGGAGAGG - Intronic
1168705393 19:58467597-58467619 AACCCCCCCAGGGCAGGGAGAGG - Exonic
925174075 2:1770157-1770179 AACACAGCCAGGGCTGGGAATGG + Intergenic
926055465 2:9771517-9771539 AAGCCTGTCTGGGCTGGGAGAGG + Intergenic
927613125 2:24562520-24562542 ACCCCTAGTAGGGCTGGAAGAGG + Intronic
927659470 2:24980735-24980757 AACAATAACAGGGCTGGGCGTGG + Intergenic
928595887 2:32858474-32858496 CACCCTCCCAGGGGTGGTAGTGG - Intergenic
929071840 2:38038860-38038882 AAACCTATCAGGGCAGGGATGGG - Intronic
930042557 2:47138973-47138995 TACCTTAACAGGGCTGGCAGCGG - Intronic
931693225 2:64852837-64852859 ATCCCTGGCAGGGCTGTGAGAGG + Intergenic
931763060 2:65433047-65433069 AACCCAACCAGAGAGGGGAGGGG + Intergenic
933744586 2:85561378-85561400 AAGCCTACCTGAGCTGGGCGAGG + Exonic
934081205 2:88469143-88469165 TACCCTGTCAGGGCTGAGAGCGG + Intergenic
934677727 2:96261437-96261459 AACCCATCCTGGGCTGGGTGTGG - Intronic
936078385 2:109416224-109416246 TACCCAACCTGGGCTGGGCGTGG - Intronic
936435568 2:112502344-112502366 AACCCATCCAGGGCTTGGTGTGG + Intronic
937350114 2:121155318-121155340 AAACCTGCCTGGGCTTGGAGAGG + Intergenic
938339138 2:130523807-130523829 AGCCCACCCAGGCCTGGGAGAGG - Intronic
938550244 2:132373676-132373698 AACTCTACCAGGAATAGGAGTGG - Intergenic
940910176 2:159203493-159203515 AAGCCTATCAAGGCTGGGCGTGG - Intronic
942326200 2:174778915-174778937 CACACTGCCAGGACTGGGAGTGG - Intergenic
944413672 2:199463861-199463883 GCCCCTACGAGGGGTGGGAGCGG - Intronic
946929220 2:224655717-224655739 ATCCGTGCCAGGGCTGGGGGCGG - Intergenic
948217462 2:236242431-236242453 AACCATACAAGAGCTGGGAGTGG - Intronic
948294259 2:236848918-236848940 AACCCAACCAGGTCTCGCAGAGG + Intergenic
948375787 2:237519570-237519592 AGCTGTTCCAGGGCTGGGAGAGG - Intronic
949064279 2:241980116-241980138 ATCCCTGCCGAGGCTGGGAGTGG - Intergenic
1169444389 20:5659288-5659310 AACCTTGCCAGGGTTGGGGGTGG + Intergenic
1170066424 20:12315670-12315692 ATCCACAGCAGGGCTGGGAGAGG - Intergenic
1172137517 20:32697275-32697297 AACCCAAGCAGGGCTGGGTGTGG + Intergenic
1173959105 20:47057545-47057567 AAACCTACCAGGACTGCAAGTGG - Intronic
1174946311 20:54989700-54989722 AATCCACCCAGGGCTGGGCGTGG + Intergenic
1175189938 20:57204675-57204697 CACCCTCCCATGGCTAGGAGTGG - Intronic
1175767855 20:61603527-61603549 TGCCCTACCAGGTGTGGGAGGGG + Intronic
1175890143 20:62312371-62312393 AGCCCTCCCCGGGCTGGGGGTGG - Intronic
1175915519 20:62424056-62424078 AAGCCTACCGGGGCGGGGAGGGG + Intronic
1176102600 20:63371364-63371386 ATCCCCACCAGGGCTGGGACAGG - Intronic
1176215733 20:63946785-63946807 AACTCTGCCTGGGCTGGGCGTGG + Intronic
1177076695 21:16584399-16584421 TTCCTAACCAGGGCTGGGAGTGG + Intergenic
1177167583 21:17619912-17619934 AATTCTACCAAGGCTGAGAGAGG - Intergenic
1179017107 21:37603418-37603440 ACCCCTGCCAAGGCTGGCAGGGG - Intergenic
1179420637 21:41233668-41233690 TACTCTACCAGGGCTGGGCAAGG + Intronic
1179604084 21:42501418-42501440 AAATTTACCAGGGCCGGGAGCGG + Intronic
1179912036 21:44455663-44455685 CACGCTCCCAGGGCTGGGCGGGG - Intronic
1180644698 22:17328956-17328978 AACCTTATCTGGGCTGGGCGAGG - Intergenic
1180970325 22:19811764-19811786 CACACAACCAGGGCTGGGATGGG - Intronic
1181013390 22:20055018-20055040 AAGCCTACCAGGGGTGGGGAAGG + Intronic
1181719727 22:24764246-24764268 AAGTCTCCCAGGGATGGGAGTGG + Intronic
1182057548 22:27371587-27371609 AACGCTGACAGGTCTGGGAGAGG + Intergenic
1182079387 22:27518427-27518449 ACCCCCACCAGGACTGGGACTGG - Intergenic
1182519151 22:30875660-30875682 AACCCTGCCAGGGCCAGGCGCGG - Intronic
1183404440 22:37623553-37623575 AACTGTACCAGCGCTGTGAGCGG + Exonic
1183457097 22:37928831-37928853 AACCCTATCCTGGCTGGGCGTGG + Intronic
1184074835 22:42169696-42169718 CACCCTCCCAGGGCCAGGAGGGG + Intronic
1184117899 22:42432590-42432612 AAGCCCACCAGGGGTTGGAGTGG - Intergenic
1184221990 22:43106849-43106871 AACTAAACCACGGCTGGGAGCGG + Intergenic
1184455764 22:44608754-44608776 AATCCTGCCTGGGCTGGGATGGG - Intergenic
1185383404 22:50520851-50520873 AACCCTACAAGGGTCGGGCGTGG - Intronic
950565672 3:13768296-13768318 AACCCCAGCTGGGCTGGGGGAGG + Intergenic
953606807 3:44417769-44417791 ACTCCTACCAGGACTGGGAGTGG - Intergenic
959597314 3:108142638-108142660 AACCTAACCCGGTCTGGGAGGGG - Intergenic
962521393 3:136200593-136200615 AAACCTACCAGGGTTGGGCACGG + Intergenic
963106175 3:141649051-141649073 AAACAAACCAGGGCTGGGCGCGG + Intergenic
963867746 3:150380759-150380781 AATCCAACCAAGGCTGGGTGTGG + Intergenic
964646773 3:158967220-158967242 AAGCCTATCTGGGCTGGGTGTGG + Intronic
964740042 3:159955440-159955462 AACCCTACCTCAGCTGGGCGTGG + Intergenic
967286875 3:187880175-187880197 AACCCTAGCATGGCTGGGTGTGG - Intergenic
968520071 4:1031202-1031224 AGCCCAACCAGGGCAGAGAGAGG + Intergenic
968814262 4:2813565-2813587 GGCCCTGGCAGGGCTGGGAGTGG + Intronic
968873234 4:3252092-3252114 AACCCAACCTGTGCTCGGAGTGG - Intronic
969601097 4:8176851-8176873 ACCCCTTCCATGGATGGGAGAGG - Intergenic
971066068 4:23035019-23035041 AACTTTACCAGGGCTGAGAAGGG - Intergenic
971332397 4:25692986-25693008 AACCCTTCCAGGGCTGGGCATGG + Intergenic
972185256 4:36520466-36520488 GCCCCTAACAGGGCTGGGCGCGG - Intergenic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
973694713 4:53478938-53478960 AACCCTATTATGGTTGGGAGTGG - Intronic
975746458 4:77480196-77480218 TACACCATCAGGGCTGGGAGCGG + Intergenic
978798916 4:112736170-112736192 AACAGAACCAGGGCTGGGCGCGG + Intergenic
979485888 4:121270073-121270095 AATCCTATAAGGGCTGGGTGCGG + Intergenic
981800313 4:148648057-148648079 ATCACTCCCAGGGCTGGGAGGGG + Intergenic
983071579 4:163274016-163274038 GAGCGTTCCAGGGCTGGGAGTGG + Intergenic
983444532 4:167833135-167833157 AAGCTTACCAGCGCTGGGACTGG + Intergenic
985080483 4:186259576-186259598 ATACCTAACAGGGCTGGGTGTGG - Intergenic
985794680 5:1953198-1953220 CACCCAACCTGGGGTGGGAGAGG + Intergenic
987817873 5:22927458-22927480 AACCCTATAAGGGCTGGGCATGG - Intergenic
988835788 5:35031032-35031054 AACCATGCCAGGGCTGAGAGTGG + Intronic
989316206 5:40082055-40082077 AATACTCCCAGGTCTGGGAGAGG + Intergenic
990570930 5:57077885-57077907 AACACTACCAAGGCTGGGCACGG - Intergenic
990597146 5:57323229-57323251 AACCCTCCCAGGGCAGCCAGTGG - Intergenic
990737774 5:58882223-58882245 TACCCTTTCAGGGCTAGGAGTGG + Intergenic
990740944 5:58912074-58912096 AAAGATACCAGGGCTGGGCGCGG - Intergenic
990741113 5:58913802-58913824 AACTCAAACAGGGCTGGGCGGGG - Intergenic
990874628 5:60470229-60470251 AATTCTACAAGGGCTGAGAGAGG + Intronic
991936682 5:71808971-71808993 AACTCTACTAGGGCTGGGACTGG - Intergenic
994396902 5:99232881-99232903 AACCATATCACGGCAGGGAGGGG + Intergenic
996956461 5:129188409-129188431 CACCCCTCCAGGGCTGGGATGGG + Intergenic
997425918 5:133802538-133802560 AGCCTTACCAGAGCTGGGAAAGG + Intergenic
997432553 5:133850766-133850788 ATACTTGCCAGGGCTGGGAGCGG - Intergenic
998568830 5:143239232-143239254 AACCCTAGCAGGAAAGGGAGGGG - Intergenic
1000333835 5:160227242-160227264 AAGCCTAAAAGGGCTGGGTGTGG + Intronic
1001542981 5:172552091-172552113 AAACCAACCCGGGCTGGGTGCGG - Intergenic
1005187413 6:23178668-23178690 ATTTCAACCAGGGCTGGGAGAGG - Intergenic
1006735971 6:36272755-36272777 CACCCTGCTTGGGCTGGGAGGGG - Intronic
1006939505 6:37742580-37742602 AACCCAGCAAAGGCTGGGAGAGG - Intergenic
1012731856 6:102893236-102893258 ACACCAACCAGGGCTGGGGGTGG - Intergenic
1012928213 6:105289274-105289296 ATCCCTCTCAGTGCTGGGAGGGG + Intronic
1014928419 6:127303522-127303544 AACACTACAAAGGCTGAGAGTGG + Intronic
1019260376 7:78669-78691 AACGGCACCAGGGGTGGGAGAGG + Intergenic
1020018130 7:4843619-4843641 AACCCTACAAAGGCTGGGTGCGG + Intronic
1021615592 7:22500017-22500039 ACCCCTCCCAAGACTGGGAGCGG + Intronic
1022864060 7:34398912-34398934 CAGCCTACCAAGGCTGAGAGTGG + Intergenic
1023488347 7:40711077-40711099 ATGCCTACCAGGGCTGGGCAGGG + Intronic
1023940323 7:44765251-44765273 AAACAGCCCAGGGCTGGGAGGGG + Intronic
1024873454 7:53993098-53993120 AAACCTAACAGGGCTTGAAGAGG - Intergenic
1028376909 7:90154618-90154640 ACCCCTCCCAAGACTGGGAGCGG - Intronic
1029506626 7:100967016-100967038 ACCCCCACCAGGGCAGGGAGGGG + Intronic
1030341152 7:108382303-108382325 AACACTAACAAGGCTGGGCGCGG + Intronic
1031173059 7:118315500-118315522 AACCCCATCATGGCTGGGCGTGG - Intergenic
1031924038 7:127621051-127621073 AACTCTCCAAGGGCTGGCAGAGG - Intergenic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1033921532 7:146398802-146398824 AGGCCCACCAGGGCAGGGAGAGG + Intronic
1034177078 7:149108601-149108623 AATCCTTCCAGGACTGGGTGTGG + Intronic
1034273815 7:149815519-149815541 AACCAGACCAGCCCTGGGAGGGG - Intergenic
1034349850 7:150408513-150408535 GCCCCTCTCAGGGCTGGGAGTGG + Intronic
1034350424 7:150411538-150411560 AAACTGACCAGGGCTGGGATGGG + Intronic
1035045293 7:155961756-155961778 AGCCAGCCCAGGGCTGGGAGGGG + Intergenic
1035296956 7:157872769-157872791 AGCCCTGACAGGGCGGGGAGGGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039384044 8:37115819-37115841 AACTCTACCAAGGCTGAGAGAGG - Intergenic
1043525851 8:81095785-81095807 AACCTTGCCAAGGCTGGCAGTGG - Intronic
1045883370 8:107066592-107066614 GAGCCTACCAGGGGAGGGAGAGG + Intergenic
1047499337 8:125430009-125430031 CACGCCCCCAGGGCTGGGAGGGG - Intergenic
1049223981 8:141440979-141441001 CCCCCTCCAAGGGCTGGGAGTGG + Intergenic
1049311036 8:141933980-141934002 GCCTCTACCAGGGCAGGGAGGGG + Intergenic
1049600466 8:143505152-143505174 AGCCCCTCCAGGGATGGGAGAGG + Intronic
1049615714 8:143575062-143575084 GACTCTGCCAGGGATGGGAGCGG + Exonic
1053253548 9:36595520-36595542 AAGCCTACCAAGGCCAGGAGCGG - Intronic
1055066823 9:72127346-72127368 AATCCTTCCTGGGCTGGGCGCGG + Intronic
1055290455 9:74777687-74777709 AACCGTGCCAGGGCAGGAAGGGG + Intronic
1056423797 9:86456147-86456169 AACTATACCTGGGCTGGGCGCGG - Intergenic
1057550319 9:96047423-96047445 AACCCCACAGGGGCGGGGAGCGG + Intergenic
1057724395 9:97557777-97557799 AACTCTGCCAAGGCAGGGAGAGG + Intronic
1058945213 9:109849455-109849477 AACAAAACCAGGGCTGGGCGCGG + Intronic
1059111937 9:111565919-111565941 AAACCCACTAGGGCTGGGCGCGG + Intronic
1059488704 9:114648536-114648558 AAACCTACTAGGGCCGGGAATGG - Intergenic
1060926174 9:127456925-127456947 AAAACTTCCAGGGCTGGCAGAGG - Intronic
1061435377 9:130557988-130558010 AACCCTACCAGGGCCCAGACAGG - Intergenic
1062386260 9:136312670-136312692 AACCCCACCAGGATGGGGAGAGG - Intergenic
1062456172 9:136640227-136640249 AACCATCCCAGGGCTGGGTGCGG - Intergenic
1062744323 9:138201803-138201825 AACGGCACCAGGGGTGGGAGAGG - Intergenic
1185645708 X:1614230-1614252 GACCGTGCCAGGGCTGGGCGTGG - Intergenic
1186581015 X:10818708-10818730 AACCCTCAAAGAGCTGGGAGGGG + Intronic
1187473521 X:19589827-19589849 AAACCCATCAGGGCTGGGCGCGG + Intronic
1187522855 X:20028791-20028813 AACAGTACAAGGGCAGGGAGTGG + Intronic
1189334393 X:40161801-40161823 GACCCTAACAGGGCTAGGCGCGG - Intronic
1189645000 X:43118518-43118540 AAAGATACCAGGGCTGGGTGTGG - Intergenic
1190453343 X:50602380-50602402 AACCCAACAAGGGCTGGGCACGG - Intronic
1190770577 X:53510769-53510791 AAACCTCACTGGGCTGGGAGCGG - Intergenic
1190776283 X:53554780-53554802 AACCCCACCAGCTTTGGGAGAGG - Exonic
1192564701 X:72153950-72153972 AAACCTACAAGGGAAGGGAGAGG + Intergenic
1192790713 X:74379690-74379712 AACACTTCCCAGGCTGGGAGGGG + Intergenic
1192944299 X:75949291-75949313 GATCCTTCCAGGGGTGGGAGGGG - Intergenic
1193957589 X:87881593-87881615 CACCCTTCCAGGGCTGGGCACGG + Intergenic
1194101121 X:89705369-89705391 AACCTCACCAGAGCTGGCAGGGG + Intergenic
1194858812 X:98968860-98968882 AAACCTACCAGTGGGGGGAGGGG - Intergenic
1196857862 X:120000423-120000445 CACCCCACCCGGGTTGGGAGTGG - Intergenic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1200067871 X:153513167-153513189 GAGCCTTCCGGGGCTGGGAGAGG - Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic
1200210310 X:154344218-154344240 TCCCCGACCAGGGCTGGGAAAGG - Intergenic
1200220542 X:154387874-154387896 TCCCCGACCAGGGCTGGGAAAGG + Intergenic
1200454074 Y:3366453-3366475 AACCTCACCAGAGCTGGCAGGGG + Intergenic