ID: 1148563918

View in Genome Browser
Species Human (GRCh38)
Location 17:48621939-48621961
Sequence GGTGCGGAAGAATGCAGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148563910_1148563918 7 Left 1148563910 17:48621909-48621931 CCGAAGAGAGTTGATTTCAGAGC 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1148563918 17:48621939-48621961 GGTGCGGAAGAATGCAGGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148563918 Original CRISPR GGTGCGGAAGAATGCAGGGC CGG Exonic
900185668 1:1332067-1332089 GGTGCGGAAGAAGGAGGGGAAGG - Exonic
901239321 1:7683841-7683863 GGTGCTGAGGAAAGCAGGCCTGG - Intronic
901808171 1:11750659-11750681 GGTGCCTAGGGATGCAGGGCTGG + Exonic
902218051 1:14947091-14947113 GGTGGGAAAGAAAGCAGGGCTGG + Intronic
902927317 1:19704689-19704711 GGTGCGGCTGCCTGCAGGGCTGG + Intronic
904437556 1:30508503-30508525 GGGGATAAAGAATGCAGGGCTGG - Intergenic
904611608 1:31728936-31728958 GATGGGGAAGGATGCAGGGTGGG - Intronic
905279364 1:36839125-36839147 GGTGCGGAGGTGAGCAGGGCTGG - Intronic
905496446 1:38392504-38392526 AGTGTGGAAAAGTGCAGGGCAGG + Intergenic
906515962 1:46438925-46438947 GGGGAAGAAGAATGAAGGGCTGG + Intergenic
907509319 1:54946540-54946562 GGTGGGGAAGAATGAAGGGGCGG - Intergenic
907676918 1:56526429-56526451 GGTAGGAAAGAATGCTGGGCAGG - Intronic
908522856 1:64961564-64961586 GGAGCGGAAGGAGGTAGGGCAGG - Intronic
911083616 1:93957829-93957851 GGTGAGGAAGAAGGCAGGCTGGG - Intergenic
912720243 1:112013969-112013991 GATGGGGAAGGCTGCAGGGCTGG - Intergenic
914690452 1:150021281-150021303 GGTGAGGAAGAAGGTAGGCCAGG + Intergenic
914981616 1:152419542-152419564 GGAGAGGAAGCATGCAAGGCTGG - Intergenic
916554989 1:165886778-165886800 GGTAGGGAAGAAGGCAGGGAGGG - Intronic
920632278 1:207663945-207663967 GGTGTGGAAGACTGCAGGCAGGG - Intronic
921089635 1:211830615-211830637 GAGCCGGAAGAATGCATGGCCGG + Exonic
922322624 1:224502012-224502034 GGTGCTGAAGAATGTGGGGAGGG + Intronic
922337793 1:224631776-224631798 GCTGGGGAAAAATGCAGGGGAGG + Intronic
922339109 1:224641353-224641375 GGTGGGGAAGGATGGAGGGGAGG - Intronic
923538929 1:234874434-234874456 GGTGGGTCAGAAAGCAGGGCAGG + Intergenic
923600591 1:235399419-235399441 GGGGCAGGAGAATGGAGGGCAGG - Intronic
1067242447 10:44508133-44508155 GGTAGGGAGGAAGGCAGGGCCGG + Intergenic
1067459839 10:46450139-46450161 GATGCAGAAGAATTCAGGACTGG + Intergenic
1067627348 10:47934474-47934496 GATGCAGAAGAATTCAGGACTGG - Intergenic
1067684203 10:48457354-48457376 GGTGCTGCAGATGGCAGGGCTGG - Intronic
1072421964 10:95296863-95296885 CCTGTGGAAGAAAGCAGGGCGGG - Intergenic
1072785010 10:98273446-98273468 GGTGGGGAAGGCAGCAGGGCAGG - Intergenic
1074524142 10:114249941-114249963 GGGGAGCAAGGATGCAGGGCAGG - Intronic
1076365398 10:129918541-129918563 GGTGCGGAGGAGGGCAGGCCTGG - Intronic
1077134792 11:993130-993152 GGTGCTGAGGAAGGCAGGGATGG + Intronic
1077213109 11:1382619-1382641 GGTGATGACGAAGGCAGGGCGGG + Intergenic
1078082140 11:8211733-8211755 GGTGGGGAGGAATACAGTGCTGG + Intergenic
1079443732 11:20540421-20540443 GGTGGGGAGGGAGGCAGGGCTGG + Intergenic
1080648376 11:34203684-34203706 GGGGCAGAAGAATGCAGGGAAGG + Intronic
1081853595 11:46290455-46290477 GGGGCGGCAGAGGGCAGGGCTGG - Intronic
1081896793 11:46593779-46593801 GCGGCGGAAGGATGCCGGGCTGG + Intronic
1084013589 11:66366092-66366114 GGTGGAGAAGACGGCAGGGCAGG - Intronic
1084295565 11:68211735-68211757 GGGGTGGAGGAATGCCGGGCAGG + Intronic
1088810345 11:113387745-113387767 GGCGGGGAAGGAGGCAGGGCCGG + Intergenic
1089586162 11:119511277-119511299 GGTAGGGCAGAATTCAGGGCTGG - Intergenic
1089926859 11:122267863-122267885 CATGAGGAAGAATGCAGAGCTGG - Intergenic
1090277134 11:125428233-125428255 GGTGAGAAAGAGAGCAGGGCAGG - Intronic
1091673007 12:2466696-2466718 TGTCCGGGTGAATGCAGGGCTGG - Intronic
1094064857 12:26351386-26351408 GATCCGGGAGAATGCTGGGCAGG - Intronic
1095436607 12:42195883-42195905 GGTGGGGAAGAGTGGAAGGCAGG + Intronic
1096078592 12:48819241-48819263 GGGGTGGGAGAAGGCAGGGCTGG + Intronic
1097316891 12:58181117-58181139 GGTGGTGAAGAATGAAGGGAGGG - Intergenic
1097866124 12:64560498-64560520 GGTGGAGGAGAATGCAGTGCAGG - Intergenic
1101718477 12:107331595-107331617 GGTGGGGAAGCCTGCAGGGATGG + Intronic
1103823872 12:123720398-123720420 GTTTCAAAAGAATGCAGGGCTGG + Intronic
1109092308 13:58063916-58063938 CGTGAGGAAGAAAGAAGGGCAGG + Intergenic
1111832563 13:93347826-93347848 GCTGGGGAAGACAGCAGGGCAGG + Intronic
1112381833 13:98898228-98898250 GGTGCTGAAGAATGCCAAGCAGG - Exonic
1112462368 13:99614116-99614138 GGAGGGGATGAGTGCAGGGCAGG + Intronic
1117490261 14:56240216-56240238 GGAGGGGAAGACTGGAGGGCAGG + Intronic
1119719927 14:76883732-76883754 GGTCAGGAAGAAAGAAGGGCAGG + Intergenic
1120017314 14:79488540-79488562 GGGGCAGAAGAAGGCAGGGAAGG + Intronic
1120358412 14:83463163-83463185 GGTGTGGAAGCCTGCAGAGCAGG - Intergenic
1121457027 14:94044829-94044851 GGTGCTGAAGTCTGCAGGACAGG - Intronic
1121740807 14:96251133-96251155 GTTGGGGAAGAATTCATGGCAGG - Intronic
1121751776 14:96363477-96363499 GGGGCGGAAGAAGGCGGGGAGGG + Exonic
1128749811 15:70140799-70140821 GCTGGAGAAGAAGGCAGGGCAGG + Intergenic
1128775377 15:70316328-70316350 GGTGAGCAAGAGGGCAGGGCCGG + Intergenic
1129231570 15:74199857-74199879 GGTGCTGAAGGATGCAGAGGAGG + Intronic
1129474442 15:75775602-75775624 GGTGGGGAGGAAGGCAGGGTTGG - Intergenic
1131190317 15:90310145-90310167 TGTGCGTAAGGCTGCAGGGCTGG - Intronic
1132497168 16:269323-269345 GGTGGGAAGGAGTGCAGGGCTGG + Exonic
1135101989 16:19613870-19613892 GGGGGGGATGAATGCTGGGCAGG + Intronic
1138621582 16:58215670-58215692 GGTGGGGATGACAGCAGGGCAGG - Intergenic
1139121874 16:64029306-64029328 GGTTGTGAAGAATCCAGGGCAGG + Intergenic
1139176528 16:64695980-64696002 AATGGGGAAGAATCCAGGGCAGG + Intergenic
1140323704 16:73979198-73979220 GGTGCAAATGAATGCAGGGGAGG - Intergenic
1140358052 16:74322674-74322696 TGTGAGAAAGAATTCAGGGCGGG - Intergenic
1142553029 17:752468-752490 GGTGAGGGTGAATGCGGGGCCGG - Intronic
1145203096 17:20964582-20964604 GGTGAGGAAGGGTGGAGGGCAGG - Intergenic
1147548870 17:41424127-41424149 GGAGCAGGAGAATGCAGAGCTGG - Exonic
1147665103 17:42141947-42141969 GGTGCTGAAGAATGGAGTCCCGG - Intronic
1148211331 17:45810606-45810628 GGTACGGAAAACTGCAGGGGTGG - Intronic
1148563918 17:48621939-48621961 GGTGCGGAAGAATGCAGGGCCGG + Exonic
1149400292 17:56289073-56289095 GTTATGGAAGAATGCAGGGATGG + Intronic
1151565924 17:74898251-74898273 GGAGCGGGGGAAGGCAGGGCGGG + Intergenic
1151680921 17:75622296-75622318 GGAGAGTAAGAATGCAGGGAAGG + Intergenic
1154280296 18:12996374-12996396 GGTGGGGAAGGCTGAAGGGCAGG + Intronic
1156121413 18:33847057-33847079 GGGGCAGAAGAATGAAGGGAGGG - Intergenic
1160437247 18:78861016-78861038 GGTTCGGGAGAATGCAGACCTGG - Intergenic
1160702440 19:514487-514509 GGTGCTCAGTAATGCAGGGCTGG - Intronic
1162050509 19:8029620-8029642 GTTCTGGAAGATTGCAGGGCTGG - Intronic
1162490506 19:10988506-10988528 GGTGAGGAAGGATGCTGGGCAGG - Intronic
1163721349 19:18899607-18899629 GGTGGGGAGGGCTGCAGGGCTGG + Exonic
1165159685 19:33808697-33808719 GGTGGGGAAGAAGGCAGAGAGGG + Intronic
1166108561 19:40609677-40609699 GGCGCGGAAGGAGGCGGGGCGGG + Intronic
1166108963 19:40611347-40611369 GGAGCGGAAGCCAGCAGGGCAGG - Exonic
1166312181 19:41969211-41969233 GGTGGGGAAGAAGGCCTGGCAGG + Intronic
1167742973 19:51335528-51335550 GATGGGGAAGACTGCAGGGTTGG + Intronic
1168190088 19:54731845-54731867 GATGAGGAAGAAGGCAGAGCAGG - Intronic
925564580 2:5236304-5236326 GGAGGGGAAGACTGCAGGGAAGG - Intergenic
926037851 2:9649046-9649068 GCTGCAGCAGAATGCAGGGTTGG + Intergenic
926066406 2:9843679-9843701 GGGGCGGAGGGCTGCAGGGCGGG + Intronic
927943963 2:27123663-27123685 GGAGGGGAAGAAGGCAGGGGAGG + Intergenic
928920070 2:36517572-36517594 GGTGGGGAAGGATGCAGCTCTGG + Intronic
929950874 2:46408786-46408808 AGTGAGGAAGAAGGCAAGGCCGG + Intergenic
929990223 2:46780509-46780531 GGTGGGGAAGGAATCAGGGCTGG + Intergenic
930667685 2:54115739-54115761 TGTTCGGAAGAGTGCAGGGTAGG + Exonic
932036707 2:68252819-68252841 GGCGGGGAAGAAGGCAAGGCTGG + Intronic
934715432 2:96540341-96540363 GGTGCGGCAGGGTGCTGGGCAGG - Intronic
935509745 2:103956541-103956563 GGTGAGAAAGAATGTAGGGAAGG - Intergenic
937909355 2:127068077-127068099 CCTGCGGTGGAATGCAGGGCTGG - Intronic
937971334 2:127551658-127551680 GAGGCGGGAGAAGGCAGGGCTGG + Intronic
939256494 2:139750543-139750565 GGTGGGGAAGGATGAAGGGCTGG + Intergenic
942458949 2:176156635-176156657 GGCGCGGAAGAAGGAGGGGCAGG - Intronic
943037308 2:182763442-182763464 TGTGCGGATGAATGCTGGGGTGG - Intronic
947596360 2:231414320-231414342 GGTGAGCAAGTATGCAAGGCAGG - Intergenic
948385137 2:237576245-237576267 AGTGGGGACAAATGCAGGGCCGG - Intronic
1171300135 20:24052754-24052776 GGTGCGGAAGCGTGCAGCGCCGG - Intergenic
1172204926 20:33156546-33156568 TTTGGTGAAGAATGCAGGGCTGG + Intergenic
1172896581 20:38304514-38304536 GTTGCCTAAGATTGCAGGGCTGG + Intronic
1175236043 20:57512535-57512557 TGTATGGAAGAATGGAGGGCTGG - Intronic
1176064773 20:63188755-63188777 GGTGCAGCAGACTGCAGGCCTGG - Intergenic
1176652553 21:9564060-9564082 GGTGAGGAAGCATGCAAGGGAGG - Intergenic
1178523743 21:33307078-33307100 GGTGCAGAGGAATGGAGGCCAGG - Intergenic
1179251325 21:39673805-39673827 GGTGCGGGAGGGAGCAGGGCAGG - Intergenic
1179559896 21:42208952-42208974 GGAGAGGAGGAATGCAGAGCTGG + Intronic
1179597230 21:42451054-42451076 GCTGCGGAGGAATTTAGGGCTGG + Intergenic
1181082503 22:20424493-20424515 GGTGGGGGAGAGTGCAGGACAGG + Intergenic
1181637557 22:24181412-24181434 GGTGCCGCAGAGTGCAGGGCGGG + Exonic
1183486023 22:38088217-38088239 AGTGCGGAGGACAGCAGGGCTGG - Intronic
1183984219 22:41560748-41560770 GCTGCTGAGGAATGCAGGGGAGG - Exonic
1184341915 22:43890945-43890967 GGGGCGGAAGGAGGGAGGGCGGG - Intronic
1184757174 22:46523614-46523636 GGGAGGGAAGAATACAGGGCAGG + Intronic
950049042 3:9972341-9972363 GGGGCTTAAGAATGCAGGGGTGG - Intronic
951428395 3:22576817-22576839 GGTGGGGAAGAAGGCAGGCATGG + Intergenic
952971569 3:38654105-38654127 GGTGGGGATGAATGCGGAGCAGG - Intergenic
953414183 3:42706021-42706043 GGTGGGGAAGGATGCAGGACCGG - Intronic
953714476 3:45306102-45306124 GGTGGGGCAGAAAGCAGAGCAGG - Intergenic
954759024 3:52860783-52860805 GGTGTGGAAGAAAGGATGGCTGG + Intronic
954984584 3:54778370-54778392 GGTGTGAGAGAATACAGGGCTGG - Intronic
955992496 3:64642891-64642913 GGTGGGGCAGTATGCAGGGAAGG + Intronic
959589301 3:108059967-108059989 TGTGGAGAAGAATGCAGTGCAGG - Intronic
961474232 3:127136794-127136816 GGTGTGGAGGTCTGCAGGGCAGG - Intergenic
965001267 3:162957152-162957174 GAAGCGGAAGAAAGCAGAGCAGG + Intergenic
967089382 3:186122261-186122283 GGTGGGGAAGAAGTCAGGGGAGG - Intronic
967494424 3:190127104-190127126 TGTGAGGAAGAGTGCAGGGATGG - Intergenic
969661761 4:8534166-8534188 GGGGTGGAAGGAGGCAGGGCTGG + Intergenic
973197739 4:47464471-47464493 GGTGCTGAAGAATTCAGTGGTGG + Intergenic
973255430 4:48107478-48107500 GCTGTGGAAGAAAACAGGGCAGG - Intronic
974213693 4:58816907-58816929 GATGCGGAAGAATGAAGAGGAGG + Intergenic
980197561 4:129610350-129610372 GGTGGGGTAGAGTGAAGGGCAGG + Intergenic
981021316 4:140031898-140031920 GGTGAGGGAGAAGGCAAGGCTGG - Intronic
985588176 5:751470-751492 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985602846 5:843933-843955 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985602872 5:844003-844025 GGGGCGGGGGCATGCAGGGCAGG + Intronic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
985787089 5:1902132-1902154 GGAGCGGAACCATGCTGGGCAGG + Intergenic
986192296 5:5508848-5508870 GGTGCAGAGGAAAGCAGAGCTGG - Intergenic
986386828 5:7242920-7242942 GGTGCGCAAGAATGGAAGGGGGG + Intergenic
986718402 5:10540380-10540402 GGTAAGGAAGAATCCAGGCCAGG + Intergenic
988688779 5:33550796-33550818 GATGCGGAACAGGGCAGGGCAGG - Intronic
989190571 5:38666232-38666254 GGTGCAGATGCATGAAGGGCTGG + Intergenic
990515481 5:56527488-56527510 GGTGGGGCAGATTGCAGAGCAGG + Intronic
993001409 5:82384960-82384982 GGGACGGAAGAAGGAAGGGCAGG + Intronic
993095059 5:83471862-83471884 GATGCGGGAGGATGCGGGGCTGG - Exonic
993391294 5:87321905-87321927 GGTGCAGATGAAAGGAGGGCAGG + Intronic
996105441 5:119496705-119496727 GGGGAGGAAGAAAGCAGGGAGGG - Intronic
996369348 5:122736690-122736712 GGTGCTGAAGAGGCCAGGGCAGG + Intergenic
996862912 5:128084721-128084743 GCTGGGGAAGAAGGGAGGGCTGG - Intronic
998401044 5:141849393-141849415 GGAGATGAAGAACGCAGGGCCGG - Intergenic
999127646 5:149258272-149258294 GGCGCTGAAGGAGGCAGGGCAGG - Exonic
999264255 5:150256269-150256291 GGTGGGGAAGAAGGCAGGCTGGG - Intronic
999327528 5:150652248-150652270 GGAGCTGCAGAATGAAGGGCGGG - Exonic
1000546077 5:162604386-162604408 GGTGCAGAAGAGAGAAGGGCTGG + Intergenic
1001710210 5:173772396-173772418 GGTGGGGCAGAAAGGAGGGCAGG - Intergenic
1002417513 5:179128151-179128173 GGGGAGGAAGCATGGAGGGCAGG - Intronic
1003134459 6:3423590-3423612 AGTGGGGAGGAATGCAGGGAGGG + Intronic
1004816749 6:19319327-19319349 GGGGCGGAAGAATGGAAGGATGG - Intergenic
1005832402 6:29681167-29681189 GGAGCGGAAGAGGGCGGGGCCGG - Intergenic
1005873076 6:29991519-29991541 GGTTGGGAAGAATGTAGGGGTGG + Intergenic
1007246662 6:40468227-40468249 GGTGGGGAAGAAGGCAGTGAGGG - Intronic
1007417496 6:41700623-41700645 GCTGCGGGAGACTGCAGGGCTGG + Intronic
1007625931 6:43246504-43246526 GGCCAGGAAGAATGCAGAGCAGG + Intronic
1010203072 6:73299617-73299639 AGGGCGGAAGGATGCAGGGGCGG + Intronic
1013455222 6:110323877-110323899 GGTGAGGAAGTAGGCAGGGGAGG + Intronic
1014001467 6:116370746-116370768 GGAGCGGGAGAAAGCGGGGCGGG + Intronic
1015631686 6:135237691-135237713 GGTGCTGAAGGGGGCAGGGCAGG + Intergenic
1018211629 6:161488054-161488076 AGTGATGAAGAAAGCAGGGCTGG + Intronic
1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG + Intergenic
1019540811 7:1550221-1550243 GGTGCGGGAGAATGCAGCCCCGG + Intronic
1020276959 7:6630360-6630382 GATGAGGAGGCATGCAGGGCTGG + Intergenic
1023718419 7:43067934-43067956 GCTGGGGAAGAATGGAAGGCAGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026593633 7:71716279-71716301 CGTGGGGGAGAATGCAGGACAGG + Intergenic
1029693976 7:102201365-102201387 GATGCGGAGGAAGGCTGGGCCGG - Exonic
1032059770 7:128714909-128714931 GCCGCGGCAGAATGCAGAGCAGG + Intronic
1032566676 7:132954078-132954100 GGTGTGGTAGAAAGCAGGGGAGG + Intronic
1032973493 7:137193711-137193733 AGTGCGAAAGAAAGCAGGGAAGG + Intergenic
1033871394 7:145758417-145758439 GGAGGGCAAGAATGCAGGGAGGG - Intergenic
1034972944 7:155430517-155430539 GTTGCGGAAGAGAGGAGGGCAGG + Intergenic
1035057315 7:156044154-156044176 GGTGCAGAAGAGTGCAGGGTAGG - Intergenic
1035635079 8:1138360-1138382 GTGGGGGAAGCATGCAGGGCAGG - Intergenic
1035876466 8:3195243-3195265 GATGCGGGAGAAGACAGGGCAGG + Intronic
1036908652 8:12732138-12732160 GTTGTGGAAGACGGCAGGGCAGG - Intronic
1037281625 8:17247550-17247572 GGTGCGGCAGGAGGCAGGGAGGG - Intronic
1047259157 8:123240935-123240957 GGTACCGGAGATTGCAGGGCAGG + Intronic
1049867470 8:144948105-144948127 TGTGGGGAAGAAAGAAGGGCTGG + Intronic
1052150500 9:25109152-25109174 GGATAGGAAGAATGCAGGCCAGG - Intergenic
1052502178 9:29305929-29305951 AGAGGGGAAGAAAGCAGGGCTGG + Intergenic
1053051011 9:34960237-34960259 TGTGTGGAAGAAAGCAGGGAAGG - Intronic
1053692290 9:40592571-40592593 GGCCAGGAAGAAGGCAGGGCCGG - Intergenic
1054272509 9:63044914-63044936 GGCCAGGAAGAAGGCAGGGCCGG + Intergenic
1054303549 9:63393537-63393559 GGCCAGGAAGAAGGCAGGGCCGG - Intergenic
1054402327 9:64720047-64720069 GGCCAGGAAGAAGGCAGGGCCGG - Intergenic
1057076157 9:92139157-92139179 GGTGGGGGAGAAAGCAGGGAAGG + Intergenic
1057439754 9:95074339-95074361 GGGTGGGAAGAATGAAGGGCAGG - Intronic
1057973105 9:99576117-99576139 GGTGGAGAAGACTGCAGGGCTGG - Intergenic
1059954287 9:119499852-119499874 GGTCCAGAAGAAAGCAGTGCAGG + Intronic
1203630282 Un_KI270750v1:67601-67623 GGTGAGGAAGCATGCAAGGGAGG - Intergenic
1185641805 X:1592567-1592589 GGTGCGAAAGAAGGGAGGGAGGG - Intronic
1186686768 X:11933165-11933187 GGTGCAGATGAATCTAGGGCTGG - Intergenic
1192318065 X:70067196-70067218 GGTGGGAAAGATTGCATGGCTGG + Intergenic
1194774419 X:97944723-97944745 GGTGCCCACAAATGCAGGGCTGG - Intergenic
1196431790 X:115634941-115634963 GGTGCAGAAGATTTGAGGGCTGG + Exonic
1200061213 X:153484637-153484659 GGAACGCAAGGATGCAGGGCGGG - Intronic
1201625704 Y:16012233-16012255 GGTGAGGAAGAAAGGAGGGAGGG + Intergenic